Mutants (Isolated)

tm1441

Allele Nametm1441
Sequence NameT19H12.2
CGC NameT19H12.2
Worm BaseAllele Name tm1441
CGC Name T19H12.2
Sequence T19H12.2
Phenotypehomozygous viable. Dr. H. Sawa: not Psa.
Mutation site27749/27750-28292/28293 (543 bp deletion)
ChromosomeV
Putative gene structurejoin(28042..28164, 28215..28688, 28742..28822)
Map position-3.76
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCGCGATAATATCCGCCAT,ExtRev:ATGCCGTACTACTGGCGCAA,ExtFwd:TGATGACCATGATCCGCGAT,IntRev:GCCAACACTGTAACCGCCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Schultz J, Lee SJ, Cole T, Hoang HD, Vibbert J, Cottee PA, Miller MA, Han SM.
The secreted MSP domain of C. elegans VAPB homolog VPR-1 patterns the adult striated muscle mitochondrial reticulum via SMN-1.
Development 2017 144(12) 2175-2186 
[ PubMed ID = 28634272 ] [ RRC reference ]

Han SM, Tsuda H, Yang Y, Vibbert J, Cottee P, Lee SJ, Winek J, Haueter C, Bellen HJ, Miller MA.
Secreted VAPB/ALS8 major sperm protein domains modulate mitochondrial localization and morphology via growth cone guidance receptors.
Dev Cell 2012 22(2) 348-62 
[ PubMed ID = 22264801 ] [ RRC reference ]