Mutants (Isolated)

tm1422

Allele Name

tm1422

Sequence Name

B0410.2

CGC Name

vang-1

Worm Base

Allele Name

tm1422

CGC Name

vang-1

Sequence

B0410.2

Phenotype

homozygous viable. Dr. A. Colavita: ectopic VC axons. Dr. G. Garriga: no obvious HSN or Q neuroblast migration defects. Dr. H. Sawa: no Psa phenotype. Dr. C. Yang: normal cell death phenotype.

Mutation site

1420/1421-2016/2017 (596 bp deletion)

Chromosome

Putative gene structure

join(416..571, 1384..1517, 1568..1700, 1753..1971, 2739..3181, 3526..3744, 3796..3964, 4720..4845)

Map position

-12.68

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GCTCTGGGTACCAATATGTG,IntFwd:GCCAGTAGGTAACCAATTCA,ExtRev:GCCAGCGCCAATGTTCAATG,IntRev:GTCTGGATCGCGAACAATAG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Chen CH, He CW, Liao CP, Pan CL.
A Wnt-planar polarity pathway instructs neurite branching by restricting F-actin assembly through endosomal signaling.
PLoS Genet. 2017 13(4) e1006720
[ PubMed ID = 28384160 ] [ RRC reference ]

Shah PK, Tanner MR, Kovacevic I, Rankin A, Marshall TE, Noblett N, Tran NN, Roenspies T, Hung J, Chen Z, Slatculescu C, Perkins TJ, Bao Z, Colavita A.
PCP and SAX-3/Robo Pathways Cooperate to Regulate Convergent Extension-Based Nerve Cord Assembly in C. elegans.
Dev. Cell 2017 41(2) 195-203.e3
[ PubMed ID = 28441532 ] [ RRC reference ]

Chien J, Devkota R, Yosef N, Mörck C.
Regulation of Axon Guidance by the Wnt Receptor Ror/CAM-1 in the PVT Guidepost Cell in Caenorhabditis elegans.
Genetics 2017 207(4) 1533-1545
[ PubMed ID = 28993416 ] [ RRC reference ]

Yamamoto Y, Takeshita H, Sawa H.
Multiple Wnts redundantly control polarity orientation in Caenorhabditis elegans epithelial stem cells.
PLoS Genet. 2011 7(10) e1002308
[ PubMed ID = 22022276 ] [ RRC reference ]

Hoffmann M, Segbert C, Helbig G, Bossinger O.
Intestinal tube formation in Caenorhabditis elegans requires vang-1 and egl-15 signaling.
Dev. Biol. 2010 339(2) 268-79
[ PubMed ID = 20004187 ] [ RRC reference ]

Carr D, Sanchez-Alvarez L, Imai JH, Slatculescu C, Noblett N, Mao L, Beese L, Colavita A.
A Farnesyltransferase Acts to Inhibit Ectopic Neurite Formation in C. elegans.
PLoS ONE 2016 11(6) e0157537
[ PubMed ID = 27300162 ] [ RRC reference ]

Chien SC, Gurling M, Kim C, Craft T, Forrester W, Garriga G.
Autonomous and nonautonomous regulation of Wnt-mediated neuronal polarity by the C. elegans Ror kinase CAM-1.
Dev. Biol. 2015 404(1) 55-65
[ PubMed ID = 25917219 ] [ RRC reference ]

Mentink RA, Middelkoop TC, Rella L, Ji N, Tang CY, Betist MC, van Oudenaarden A, Korswagen HC.
Cell intrinsic modulation of Wnt signaling controls neuroblast migration in C. elegans.
Dev. Cell 2014 31(2) 188-201
[ PubMed ID = 25373777 ] [ RRC reference ]

Kulkarni G, Xu Z, Mohamed AM, Li H, Tang X, Limerick G, Wadsworth WG.
Experimental evidence for UNC-6 (netrin) axon guidance by stochastic fluctuations of intracellular UNC-40 (DCC) outgrowth activity.
Biol Open 2013 2(12) 1300-12
[ PubMed ID = 24337114 ] [ RRC reference ]

Honnen SJ, Büchter C, Schröder V, Hoffmann M, Kohara Y, Kampkötter A, Bossinger O.
C. elegans VANG-1 modulates life span via insulin/IGF-1-like signaling.
PLoS ONE 2012 7(2) e32183
[ PubMed ID = 22359667 ] [ RRC reference ]

Steimel A, Wong L, Najarro EH, Ackley BD, Garriga G, Hutter H.
The Flamingo ortholog FMI-1 controls pioneer-dependent navigation of follower axons in C. elegans.
Development 2010 137(21) 3663-73
[ PubMed ID = 20876647 ] [ RRC reference ]

Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet. 2011 7(9) e1002257
[ PubMed ID = 21912529 ] [ RRC reference ]