Mutants (Isolated)

tm1422

Allele Nametm1422
Allele TypeNormal
Sequence NameB0410.2
Gene Namevang-1
Worm BaseAllele Name tm1422
Gene Name vang-1
Sequence B0410.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Colavita: ectopic VC axons. Dr. G. Garriga: no obvious HSN or Q neuroblast migration defects. Dr. H. Sawa: no Psa phenotype. Dr. C. Yang: normal cell death phenotype.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1420/1421-2016/2017 (596 bp deletion)
ChromosomeX
Putative gene structurejoin(416..571, 1384..1517, 1568..1700, 1753..1971, 2739..3181, 3526..3744, 3796..3964, 4720..4845)
Map position-12.68
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTCTGGGTACCAATATGTG,IntFwd:GCCAGTAGGTAACCAATTCA,ExtRev:GCCAGCGCCAATGTTCAATG,IntRev:GTCTGGATCGCGAACAATAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schön JL, Groß VE, Post WB, Daum A, Matúš D, Pilz J, Schnorr R, Horn S, Bäumers M, Weidtkamp-Peters S, Hughes S, Schöneberg T, Prömel S.
The adhesion GPCR and PCP component flamingo (FMI-1) alters body size and regulates the composition of the extracellular matrix.
Matrix Biol 2024 128 1-10 
[ PubMed ID = 38378098 ] [ RRC reference ]

Riva C, Hajduskova M, Gally C, Suman SK, Ahier A, Jarriault S.
A natural transdifferentiation event involving mitosis is empowered by integrating signaling inputs with conserved plasticity factors.
Cell Rep 2022 40(12) 111365 
[ PubMed ID = 36130499 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J Cell Biol 2019 218(1) 125-133 
[ PubMed ID = 30396999 ] [ RRC reference ]

Mentink RA, Rella L, Radaszkiewicz TW, Gybel T, Betist MC, Bryja V, Korswagen HC.
The planar cell polarity protein VANG-1/Vangl negatively regulates Wnt/β-catenin signaling through a Dvl dependent mechanism.
PLoS Genet 2018 14(12) e1007840 
[ PubMed ID = 30532125 ] [ RRC reference ]

He CW, Liao CP, Chen CK, Teulière J, Chen CH, Pan CL.
The polarity protein VANG-1 antagonizes Wnt signaling by facilitating Frizzled endocytosis.
Development 2018 145(24)  
[ PubMed ID = 30504124 ] [ RRC reference ]

Asan A, Raiders SA, Priess JR.
Morphogenesis of the C. elegans Intestine Involves Axon Guidance Genes.
PLoS Genet 2016 12(4) e1005950 
[ PubMed ID = 27035721 ] [ RRC reference ]

Chien J, Devkota R, Yosef N, Mörck C.
Regulation of Axon Guidance by the Wnt Receptor Ror/CAM-1 in the PVT Guidepost Cell in Caenorhabditis elegans.
Genetics 2017 207(4) 1533-1545 
[ PubMed ID = 28993416 ] [ RRC reference ]

Shah PK, Tanner MR, Kovacevic I, Rankin A, Marshall TE, Noblett N, Tran NN, Roenspies T, Hung J, Chen Z, Slatculescu C, Perkins TJ, Bao Z, Colavita A.
PCP and SAX-3/Robo Pathways Cooperate to Regulate Convergent Extension-Based Nerve Cord Assembly in C. elegans.
Dev Cell 2017 41(2) 195-203.e3 
[ PubMed ID = 28441532 ] [ RRC reference ]

Chen CH, He CW, Liao CP, Pan CL.
A Wnt-planar polarity pathway instructs neurite branching by restricting F-actin assembly through endosomal signaling.
PLoS Genet 2017 13(4) e1006720 
[ PubMed ID = 28384160 ] [ RRC reference ]

Carr D, Sanchez-Alvarez L, Imai JH, Slatculescu C, Noblett N, Mao L, Beese L, Colavita A.
A Farnesyltransferase Acts to Inhibit Ectopic Neurite Formation in C. elegans.
PLoS One 2016 11(6) e0157537 
[ PubMed ID = 27300162 ] [ RRC reference ]

Hoffmann M, Segbert C, Helbig G, Bossinger O.
Intestinal tube formation in Caenorhabditis elegans requires vang-1 and egl-15 signaling.
Dev Biol 2010 339(2) 268-79 
[ PubMed ID = 20004187 ] [ RRC reference ]

Steimel A, Wong L, Najarro EH, Ackley BD, Garriga G, Hutter H.
The Flamingo ortholog FMI-1 controls pioneer-dependent navigation of follower axons in C. elegans.
Development 2010 137(21) 3663-73 
[ PubMed ID = 20876647 ] [ RRC reference ]

Yamamoto Y, Takeshita H, Sawa H.
Multiple Wnts redundantly control polarity orientation in Caenorhabditis elegans epithelial stem cells.
PLoS Genet 2011 7(10) e1002308 
[ PubMed ID = 22022276 ] [ RRC reference ]

Sanchez-Alvarez L, Visanuvimol J, McEwan A, Su A, Imai JH, Colavita A.
VANG-1 and PRKL-1 cooperate to negatively regulate neurite formation in Caenorhabditis elegans.
PLoS Genet 2011 7(9) e1002257 
[ PubMed ID = 21912529 ] [ RRC reference ]

Honnen SJ, Büchter C, Schröder V, Hoffmann M, Kohara Y, Kampkötter A, Bossinger O.
C. elegans VANG-1 modulates life span via insulin/IGF-1-like signaling.
PLoS One 2012 7(2) e32183 
[ PubMed ID = 22359667 ] [ RRC reference ]

Kulkarni G, Xu Z, Mohamed AM, Li H, Tang X, Limerick G, Wadsworth WG.
Experimental evidence for UNC-6 (netrin) axon guidance by stochastic fluctuations of intracellular UNC-40 (DCC) outgrowth activity.
Biol Open 2013 2(12) 1300-12 
[ PubMed ID = 24337114 ] [ RRC reference ]

Mentink RA, Middelkoop TC, Rella L, Ji N, Tang CY, Betist MC, van Oudenaarden A, Korswagen HC.
Cell intrinsic modulation of Wnt signaling controls neuroblast migration in C. elegans.
Dev Cell 2014 31(2) 188-201 
[ PubMed ID = 25373777 ] [ RRC reference ]

Chien SC, Gurling M, Kim C, Craft T, Forrester W, Garriga G.
Autonomous and nonautonomous regulation of Wnt-mediated neuronal polarity by the C. elegans Ror kinase CAM-1.
Dev Biol 2015 404(1) 55-65 
[ PubMed ID = 25917219 ] [ RRC reference ]