Mutants (Isolated)

tm1421

Allele Nametm1421
Allele TypeNormal
Sequence NameF43E2.5
Gene Namemsra-1
Worm BaseAllele Name tm1421
Gene Name msra-1
Sequence F43E2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Driscoll: No significant effects on age-related muscle decline.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12937/12938-13850/13851 (913 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(13045..13419, 13553..13801))
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtRev:TCTGAGCAGGTGTCACAGTG,IntRev:CAGACTGAGCCAGTCTTACT,ExtFwd:GCCACTGTCTTCGTCCAGGA,IntFwd:CCTTGCCGCCCGTCATTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pinto C, Ibáñez MR, Loyola G, León L, Salvatore Y, González C, Barraza V, Castañeda F, Aldunate R, Contreras-Porcia L, Fuenzalida K, Bronfman FC.
Characterization of an Agarophyton chilense Oleoresin Containing PPARγ Natural Ligands with Insulin-Sensitizing Effects in a C57Bl/6J Mouse Model of Diet-Induced Obesity and Antioxidant Activity in Caenorhabditis elegans.
Nutrients 2021 13(6)  
[ PubMed ID = 34071972 ] [ RRC reference ]

Minniti AN, Arriagada H, Zúñiga S, Bravo-Zehnder M, Alfaro IE, Aldunate R.
Temporal pattern of neuronal insulin release during Caenorhabditis elegans aging: Role of redox homeostasis.
Aging Cell 2019 18(1) e12855 
[ PubMed ID = 30456853 ] [ RRC reference ]

Minniti AN, Arrazola MS, Bravo-Zehnder M, Ramos F, Inestrosa NC, Aldunate R.
The protein oxidation repair enzyme methionine sulfoxide reductase a modulates Aβ aggregation and toxicity in vivo.
Antioxid Redox Signal 2015 22(1) 48-62 
[ PubMed ID = 24988428 ] [ RRC reference ]

Minniti AN, Cataldo R, Trigo C, Vasquez L, Mujica P, Leighton F, Inestrosa NC, Aldunate R.
Methionine sulfoxide reductase A expression is regulated by the DAF-16/FOXO pathway in Caenorhabditis elegans.
Aging Cell 2009 8(6) 690-705 
[ PubMed ID = 19747232 ] [ RRC reference ]