Mutants (Isolated)

tm1416

Allele Nametm1416
Sequence NameF13E6.4
CGC Nameyap-1
Worm BaseAllele Name tm1416
CGC Name yap-1
Sequence F13E6.4
Phenotypehomozygous viable. Dr. S. Boulton: non-Him, normal meiosis, not sensitive to IR or CDDP. Not required for BRC-1 focus formation after IR. Not required for FCD-2 focus formation after CDDP. Dr. J. Lee: protruding vulva.
Mutation site22405/22406-22931/22932 (526 bp deletion)
ChromosomeX
Putative gene structurejoin(21516..21668, 21977..22045, 22091..22212, 22258..22318, 22366..22717, 22974..23269, 23323..23430, 23691..23813, 23859..23948)
Map position2.37
Balancer
Map position of balancer
Sequence of primersExtRev:GGTGCAATGTATGCGGTGTC,IntRev:GTTGCGGACTGTCGACAAGT,ExtFwd:TGCCGGATGTGAGGGATGGA,IntFwd:GGGATGGAAACGCCTCCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee H, Kang J, Lee J.
Involvement of YAP-1, the Homolog of Yes-Associated Protein, in the Wnt-Mediated Neuronal Polarization in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(8) 2595-2602 
[ PubMed ID = 29853655 ] [ RRC reference ]

Iwasa H, Maimaiti S, Kuroyanagi H, Kawano S, Inami K, Timalsina S, Ikeda M, Nakagawa K, Hata Y.
Yes-associated protein homolog, YAP-1, is involved in the thermotolerance and aging in the nematode Caenorhabditis elegans.
Exp Cell Res 2013 319(7) 931-45 
[ PubMed ID = 23396260 ] [ RRC reference ]

Feng G, Zhu Z, Li WJ, Lin Q, Chai Y, Dong MQ, Ou G.
Hippo kinases maintain polarity during directional cell migration in Caenorhabditis elegans.
EMBO J 2017 36(3) 334-345 
[ PubMed ID = 28011581 ] [ RRC reference ]