Allele Name | tm1416 |
Sequence Name | F13E6.4 |
CGC Name | yap-1 |
Worm Base | Allele Name |
tm1416
|
CGC Name |
yap-1
|
Sequence |
F13E6.4
|
Phenotype | homozygous viable. Dr. S. Boulton: non-Him, normal meiosis, not sensitive to IR or CDDP. Not required for BRC-1 focus formation after IR. Not required for FCD-2 focus formation after CDDP. Dr. J. Lee: protruding vulva. |
Mutation site | 22405/22406-22931/22932 (526 bp deletion) |
Chromosome | X |
Putative gene structure | join(21516..21668, 21977..22045, 22091..22212, 22258..22318, 22366..22717, 22974..23269, 23323..23430, 23691..23813, 23859..23948) |
Map position | 2.37 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GGTGCAATGTATGCGGTGTC,IntRev:GTTGCGGACTGTCGACAAGT,ExtFwd:TGCCGGATGTGAGGGATGGA,IntFwd:GGGATGGAAACGCCTCCGAT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Lee H, Kang J, Lee J. Involvement of YAP-1, the Homolog of Yes-Associated Protein, in the Wnt-Mediated Neuronal Polarization in Caenorhabditis elegans. G3 (Bethesda) 2018 8(8) 2595-2602
[ PubMed ID = 29853655 ]
[ RRC reference ]
|
Iwasa H, Maimaiti S, Kuroyanagi H, Kawano S, Inami K, Timalsina S, Ikeda M, Nakagawa K, Hata Y. Yes-associated protein homolog, YAP-1, is involved in the thermotolerance and aging in the nematode Caenorhabditis elegans. Exp Cell Res 2013 319(7) 931-45
[ PubMed ID = 23396260 ]
[ RRC reference ]
|
Feng G, Zhu Z, Li WJ, Lin Q, Chai Y, Dong MQ, Ou G. Hippo kinases maintain polarity during directional cell migration in Caenorhabditis elegans. EMBO J 2017 36(3) 334-345
[ PubMed ID = 28011581 ]
[ RRC reference ]
|
|