Home > Mutants (Isolated) > tm1415

Mutants (Isolated)

Allele Name		tm1415
Allele Type		Normal
Sequence Name		AH9.2
Gene Name		crn-4
Worm Base	Allele Name	tm1415
	Gene Name	crn-4
	Sequence	AH9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		15094/15095-15608/15609 (514 bp deletion)
Chromosome		X
Putative gene structure		complement(join(13959..14216, 15091..15249, 15307..15569, 15628..15706, 15755..15856, 15908..15943))
Map position		-15.94
Balancer
Map position of balancer
Sequence of primers		IntRev:CGACGTCGTTGCGCATCCAT,IntFwd:GTTGTAGACCAGCGGTTGTC,ExtRev:GCTCACTTGCTGCCTGTGTC,ExtFwd:CAGCGTCCATGAAGCTGCTT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Aruscavage PJ, Hellwig S, Bass BL. Small DNA pieces in C. elegans are intermediates of DNA fragmentation during apoptosis. PLoS One 2010 5(6) e11217  [ PubMed ID = 20585459 ] [ RRC reference ] Hsiao YY, Nakagawa A, Shi Z, Mitani S, Xue D, Yuan HS. Crystal structure of CRN-4: implications for domain function in apoptotic DNA degradation. Mol Cell Biol 2009 29(2) 448-57  [ PubMed ID = 18981218 ] [ RRC reference ]