Mutants (Isolated)

tm1415

Allele Nametm1415
Sequence NameAH9.2
CGC Namecrn-4
Worm BaseAllele Name tm1415
CGC Name crn-4
Sequence AH9.2
Phenotypehomozygous viable
Mutation site15094/15095-15608/15609 (514 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(13959..14216, 15091..15249, 15307..15569, 15628..15706, 15755..15856, 15908..15943))
Map position-15.94
Balancer
Map position of balancer
Sequence of primersIntRev:CGACGTCGTTGCGCATCCAT,IntFwd:GTTGTAGACCAGCGGTTGTC,ExtRev:GCTCACTTGCTGCCTGTGTC,ExtFwd:CAGCGTCCATGAAGCTGCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hsiao YY, Nakagawa A, Shi Z, Mitani S, Xue D, Yuan HS.
Crystal structure of CRN-4: implications for domain function in apoptotic DNA degradation.
Mol. Cell. Biol. 2009 29(2) 448-57 
[ PubMed ID = 18981218 ] [ RRC reference ]

Aruscavage PJ, Hellwig S, Bass BL.
Small DNA pieces in C. elegans are intermediates of DNA fragmentation during apoptosis.
PLoS ONE 2010 5(6) e11217 
[ PubMed ID = 20585459 ] [ RRC reference ]