Mutants (Isolated)

tm1410

Allele Nametm1410
Sequence NameT23F2.1
CGC Namebus-8
Worm BaseAllele Name tm1410
CGC Name bus-8
Sequence T23F2.1
Phenotypelethal or sterile
Mutation site1727/1728-TTT-2433/2434 (706 bp deletion + 3 bp insertion)
ChromosomeX
Putative gene structurejoin(1492..1648, 1701..1824, 1878..2062, 2119..2210, 2269..2490, 2551..2766, 2827..2928, 3064..3279)
Map position-5.24
Balanceregl-13 (n483) X
Map position of balancer-4.41
Sequence of primersExtFwd:GGCGAGAAGCAGGTAAGGCT,IntFwd:CCCGATGTCCAGCTCCACAT,ExtRev:GCGCGTGGAGAATTCGGTTT,IntRev:CAAGGCGATGCCGCTGAAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Partridge FA, Tearle AW, Gravato-Nobre MJ, Schafer WR, Hodgkin J.
The C. elegans glycosyltransferase BUS-8 has two distinct and essential roles in epidermal morphogenesis.
Dev. Biol. 2008 317(2) 549-59 
[ PubMed ID = 18395708 ] [ RRC reference ]