Allele Name | tm1406 |
Sequence Name | Y41G9A.4 |
CGC Name | gbb-1 |
Worm Base | Allele Name |
tm1406
|
CGC Name |
gbb-1
|
Sequence |
Y41G9A.4
|
Phenotype | homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. J. Kaplan: J. Neurosci 28, 7104 (2008). |
Mutation site | 12233/12234-13514/13515 (1281 bp deletion) |
Chromosome | X |
Putative gene structure | join(11763..11897, 12422..12556, 12610..12707, 12753..12843, 12895..13041, 13356..13469, 13520..13701, 13896..14034, 14083..14289, 15055..15143, 15193..15331, 16279..16404, 17874..18005, 19967..20089, 20135..20216, 20261..20473, 20849..21018, 21067..21178, 21228..21308, 21358..21425) |
Map position | -12.67 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:CGAGTCTGGTGGTGGTCCTT,IntFwd:GGACTCAGTTTGGACACACA,ExtFwd:ACGTTTTGACTGCCAGTAAC,IntRev:CCCATGATCTTGTACTTTCC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Schultheis C, Brauner M, Liewald JF, Gottschalk A. Optogenetic analysis of GABAB receptor signaling in Caenorhabditis elegans motor neurons. J Neurophysiol 2011 106(2) 817-27
[ PubMed ID = 21613582 ]
[ RRC reference ]
|
Hawkins EG, Martin I, Kondo LM, Judy ME, Brings VE, Chan CL, Blackwell GG, Bettinger JC, Davies AG. A novel cholinergic action of alcohol and the development of tolerance to that effect in Caenorhabditis elegans. Genetics 2015 199(1) 135-49
[ PubMed ID = 25342716 ]
[ RRC reference ]
|
Han B, Bellemer A, Koelle MR. An evolutionarily conserved switch in response to GABA affects development and behavior of the locomotor circuit of Caenorhabditis elegans. Genetics 2015 199(4) 1159-72
[ PubMed ID = 25644702 ]
[ RRC reference ]
|
Chun L, Gong J, Yuan F, Zhang B, Liu H, Zheng T, Yu T, Xu XZ, Liu J. Metabotropic GABA signalling modulates longevity in C. elegans. Nat Commun 2015 6 8828
[ PubMed ID = 26537867 ]
[ RRC reference ]
|
Dittman JS, Kaplan JM. Behavioral impact of neurotransmitter-activated G-protein-coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion. J Neurosci 2008 28(28) 7104-12
[ PubMed ID = 18614679 ]
[ RRC reference ]
|
|