Mutants (Isolated)

tm1406

Allele Nametm1406
Sequence NameY41G9A.4
CGC Namegbb-1
Worm BaseAllele Name tm1406
CGC Name gbb-1
Sequence Y41G9A.4
Phenotypehomozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. J. Kaplan: J. Neurosci 28, 7104 (2008).
Mutation site12233/12234-13514/13515 (1281 bp deletion)
ChromosomeX
Putative gene structurejoin(11763..11897, 12422..12556, 12610..12707, 12753..12843, 12895..13041, 13356..13469, 13520..13701, 13896..14034, 14083..14289, 15055..15143, 15193..15331, 16279..16404, 17874..18005, 19967..20089, 20135..20216, 20261..20473, 20849..21018, 21067..21178, 21228..21308, 21358..21425)
Map position-12.67
Balancer
Map position of balancer
Sequence of primersExtRev:CGAGTCTGGTGGTGGTCCTT,IntFwd:GGACTCAGTTTGGACACACA,ExtFwd:ACGTTTTGACTGCCAGTAAC,IntRev:CCCATGATCTTGTACTTTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dittman JS, Kaplan JM.
Behavioral impact of neurotransmitter-activated G-protein-coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion.
J. Neurosci. 2008 28(28) 7104-12 
[ PubMed ID = 18614679 ] [ RRC reference ]

Chun L, Gong J, Yuan F, Zhang B, Liu H, Zheng T, Yu T, Xu XZ, Liu J.
Metabotropic GABA signalling modulates longevity in C. elegans.
Nat Commun 2015 6 8828 
[ PubMed ID = 26537867 ] [ RRC reference ]

Han B, Bellemer A, Koelle MR.
An evolutionarily conserved switch in response to GABA affects development and behavior of the locomotor circuit of Caenorhabditis elegans.
Genetics 2015 199(4) 1159-72 
[ PubMed ID = 25644702 ] [ RRC reference ]

Hawkins EG, Martin I, Kondo LM, Judy ME, Brings VE, Chan CL, Blackwell GG, Bettinger JC, Davies AG.
A novel cholinergic action of alcohol and the development of tolerance to that effect in Caenorhabditis elegans.
Genetics 2015 199(1) 135-49 
[ PubMed ID = 25342716 ] [ RRC reference ]

Schultheis C, Brauner M, Liewald JF, Gottschalk A.
Optogenetic analysis of GABAB receptor signaling in Caenorhabditis elegans motor neurons.
J. Neurophysiol. 2011 106(2) 817-27 
[ PubMed ID = 21613582 ] [ RRC reference ]