Mutants (Isolated)

tm1402

Allele Nametm1402
Sequence NameC29E6.2
CGC Nametrpa-1
Worm BaseAllele Name tm1402
CGC Name trpa-1
Sequence C29E6.2
Phenotypehomozygous viable. Dr. S. Shaham: no obvious defects in temperature sensation. Dr. O. Hobert: slight defects in thermotaxis. Dr. W. Schafer: Nature Neurosci. 10, 568-577 (2007).
Mutation site2255/2256-GATCAACGAGATCAAC-2836/2837 (581 bp deletion + 16 bp insertion)
ChromosomeIV
Putative gene structurejoin(1625..2064, 2625..3603, 3678..3756, 3819..3905, 9835..10000, 10053..10364, 10563..11016, 11082..11489, 11540..12010, 12057..12227)
Map position5.34
Balancer
Map position of balancer
Sequence of primersExtFwd:CCATTGGCAGTGAACGCCCA,IntFwd:CGCTTCACTATGCAGCGAGA,ExtRev:GGCTGCCAAATGCAATGCAC,IntRev:TCCGACCTGCTCCAGTTTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kindt KS, Viswanath V, Macpherson L, Quast K, Hu H, Patapoutian A, Schafer WR.
Caenorhabditis elegans TRPA-1 functions in mechanosensation.
Nat. Neurosci. 2007 10(5) 568-77 
[ PubMed ID = 17450139 ] [ RRC reference ]