Mutants (Isolated)

tm1392

Allele Nametm1392
Sequence NameC52B11.3
CGC Namedop-4
Worm BaseAllele Name tm1392
CGC Name dop-4
Sequence C52B11.3
Phenotypehomozygous viable
Mutation site22707/22708-23791/23792 (1084 bp deletion)
ChromosomeX
Putative gene structurejoin(22117..22308, 22484..22734, 22787..22951, 23379..23567, 23781..23937, 24327..24485, 24535..24702, 24797..24982, 25143..25358, 25637..25848, 27351..27389, 27431..27464, 27521..27631)
Map position-18.46
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGAGGCGGCTGTTTGCTAA,ExtFwd:CGCTGTCTGAACTCGGTCGA,IntRev:ACCACCATCCCCCTATCTAA,ExtRev:TCAGTGCAAGGCACGTTCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Topper SM, Aguilar SC, Topper VY, Elbel E, Pierce-Shimomura JT.
Alcohol disinhibition of behaviors in C. elegans.
PLoS ONE 2014 9(3) e92965 
[ PubMed ID = 24681782 ] [ RRC reference ]

Correa P, LeBoeuf B, García LR.
C. elegans dopaminergic D2-like receptors delimit recurrent cholinergic-mediated motor programs during a goal-oriented behavior.
PLoS Genet. 2012 8(11) e1003015 
[ PubMed ID = 23166505 ] [ RRC reference ]

Sellings L, Pereira S, Qian C, Dixon-McDougall T, Nowak C, Zhao B, Tyndale RF, van der Kooy D.
Nicotine-motivated behavior in Caenorhabditis elegans requires the nicotinic acetylcholine receptor subunits acr-5 and acr-15.
Eur. J. Neurosci. 2013 37(5) 743-56 
[ PubMed ID = 23351035 ] [ RRC reference ]

Ezak MJ, Ferkey DM.
The C. elegans D2-like dopamine receptor DOP-3 decreases behavioral sensitivity to the olfactory stimulus 1-octanol.
PLoS ONE 2010 5(3) e9487 
[ PubMed ID = 20209143 ] [ RRC reference ]

Safratowich BD, Hossain M, Bianchi L, Carvelli L.
Amphetamine potentiates the effects of β-phenylethylamine through activation of an amine-gated chloride channel.
J. Neurosci. 2014 34(13) 4686-91 
[ PubMed ID = 24672014 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]