Mutants (Isolated)

tm1392

Allele Nametm1392
Sequence NameC52B11.3
CGC Namedop-4
Worm BaseAllele Name tm1392
CGC Name dop-4
Sequence C52B11.3
Phenotypehomozygous viable
Mutation site22707/22708-23791/23792 (1084 bp deletion)
ChromosomeX
Putative gene structurejoin(22117..22308, 22484..22734, 22787..22951, 23379..23567, 23781..23937, 24327..24485, 24535..24702, 24797..24982, 25143..25358, 25637..25848, 27351..27389, 27431..27464, 27521..27631)
Map position-18.46
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGAGGCGGCTGTTTGCTAA,ExtFwd:CGCTGTCTGAACTCGGTCGA,IntRev:ACCACCATCCCCCTATCTAA,ExtRev:TCAGTGCAAGGCACGTTCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cao X, Aballay A.
Neural Inhibition of Dopaminergic Signaling Enhances Immunity in a Cell-Non-autonomous Manner.
Curr. Biol. 2016 26(17) 2329-34 
[ PubMed ID = 27524480 ] [ RRC reference ]

Joshi KK, Matlack TL, Rongo C.
Dopamine signaling promotes the xenobiotic stress response and protein homeostasis.
EMBO J. 2016 35(17) 1885-901 
[ PubMed ID = 27261197 ] [ RRC reference ]

Oakes M, Law WJ, Komuniecki R.
Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans.
J. Neurosci. 2019 39(21) 4142-4152 
[ PubMed ID = 30886012 ] [ RRC reference ]

Ezak MJ, Ferkey DM.
The C. elegans D2-like dopamine receptor DOP-3 decreases behavioral sensitivity to the olfactory stimulus 1-octanol.
PLoS ONE 2010 5(3) e9487 
[ PubMed ID = 20209143 ] [ RRC reference ]

Sellings L, Pereira S, Qian C, Dixon-McDougall T, Nowak C, Zhao B, Tyndale RF, van der Kooy D.
Nicotine-motivated behavior in Caenorhabditis elegans requires the nicotinic acetylcholine receptor subunits acr-5 and acr-15.
Eur. J. Neurosci. 2013 37(5) 743-56 
[ PubMed ID = 23351035 ] [ RRC reference ]

Correa P, LeBoeuf B, García LR.
C. elegans dopaminergic D2-like receptors delimit recurrent cholinergic-mediated motor programs during a goal-oriented behavior.
PLoS Genet. 2012 8(11) e1003015 
[ PubMed ID = 23166505 ] [ RRC reference ]

Topper SM, Aguilar SC, Topper VY, Elbel E, Pierce-Shimomura JT.
Alcohol disinhibition of behaviors in C. elegans.
PLoS ONE 2014 9(3) e92965 
[ PubMed ID = 24681782 ] [ RRC reference ]

Safratowich BD, Hossain M, Bianchi L, Carvelli L.
Amphetamine potentiates the effects of β-phenylethylamine through activation of an amine-gated chloride channel.
J. Neurosci. 2014 34(13) 4686-91 
[ PubMed ID = 24672014 ] [ RRC reference ]

Suo S, Harada K, Matsuda S, Kyo K, Wang M, Maruyama K, Awaji T, Tsuboi T.
Sexually Dimorphic Regulation of Behavioral States by Dopamine in Caenorhabditis elegans.
J. Neurosci. 2019 39(24) 4668-4683 
[ PubMed ID = 30988167 ] [ RRC reference ]

Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M.
A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia.
Nat Commun 2018 9(1) 5272 
[ PubMed ID = 30532051 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]