Mutants (Isolated)

tm1388

Allele Nametm1388
Sequence NameZC328.1
CGC Namecuti-1
Worm BaseAllele Name tm1388
CGC Name cuti-1
Sequence ZC328.1
Phenotypelethal or sterile
Mutation site18803/18804-19301/19302 (498 bp deletion)
ChromosomeI
Putative gene structurejoin(16854..16996, 18468..18633, 18713..18897, 19149..19251)
Map position1.07
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:TCCCTCTCACACAAGCGGGT,IntFwd:ATGCGTTTCGGGCAACAGAC,ExtRev:GGTCACATGTGACACTGCTA,IntRev:CCAGCCATGGGATATAAGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fritz JA, Behm CA.
CUTI-1: A novel tetraspan protein involved in C. elegans CUTicle formation and epithelial integrity.
PLoS ONE 2009 4(4) e5117 
[ PubMed ID = 19357781 ] [ RRC reference ]