Mutants (Isolated)

tm1369

Allele Nametm1369
Sequence NameY71H2B.10
CGC Nameapb-1
Worm BaseAllele Name tm1369
CGC Name apb-1
Sequence Y71H2B.10
Phenotypelethal or sterile. Dr. O. Blacque: could not assess Dyf.
Mutation site17523/17524-18630/18631 (1107 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(5900..5971, 6189..6343, 7026..7200, 11236..11298, 12420..13032, 13935..15051, 17172..17565, 18383..18624, 18680..18716))
Map position-11.64
Balancer
Map position of balancer
Sequence of primersExtRev:CCCCGATTTGCTTGCGCACT,IntFwd:TACTTGTCCCCATTCAGTAC,IntRev:CCGTGGCCACTTTTATCCCT,ExtFwd:CGTCAGGATCGGCAGATAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang H, Kim A, Abraham N, Khan LA, Hall DH, Fleming JT, Gobel V.
Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis.
Development 2012 139(11) 2071-83 
[ PubMed ID = 22535410 ] [ RRC reference ]