Mutants (Isolated)

tm1362

Allele Nametm1362
Sequence NameK03E6.6
CGC Namepfn-3
Worm BaseAllele Name tm1362
CGC Name pfn-3
Sequence K03E6.6
Phenotypehomozygous viable. Dr. S. Ono: Cell Motil Cytoskeleton 63, 14-28 (2006).
Mutation site25817/25818-26615/26616 (798 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(25406..25503, 25556..25679, 25726..25773, 26375..26485))
Map position-18.74
Balancer
Map position of balancer
Sequence of primersExtRev:TGATAACACTTCTGGTCCCG,IntFwd:CGCTGACGAGGTGGAGACTT,ExtFwd:TGGTCAGTCCCGGATAGCTG,IntRev:ATGTTAAGCACCTGGTCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Polet D, Lambrechts A, Ono K, Mah A, Peelman F, Vandekerckhove J, Baillie DL, Ampe C, Ono S.
Caenorhabditis elegans expresses three functional profilins in a tissue-specific manner.
Cell Motil. Cytoskeleton 2006 63(1) 14-28 
[ PubMed ID = 16317718 ] [ RRC reference ]

Yamashiro S, Cox EA, Baillie DL, Hardin JD, Ono S.
Sarcomeric actin organization is synergistically promoted by tropomodulin, ADF/cofilin, AIP1 and profilin in C. elegans.
J. Cell. Sci. 2008 121(Pt 23) 3867-77 
[ PubMed ID = 18984629 ] [ RRC reference ]

Nahabedian JF, Qadota H, Stirman JN, Lu H, Benian GM.
Bending amplitude - a new quantitative assay of C. elegans locomotion: identification of phenotypes for mutants in genes encoding muscle focal adhesion components.
Methods 2012 56(1) 95-102 
[ PubMed ID = 22126736 ] [ RRC reference ]