Mutants (Isolated)

tm1361

Allele Nametm1361
Sequence NameW09B6.3
CGC Nameeri-3
Worm BaseAllele Name tm1361
CGC Name eri-3
Sequence W09B6.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 124, 343-354 (2006). Dr. C. Bargmann: viable, fertile at 20 degree.
Mutation site2085/2086-2377/2378 (292 bp deletion)
ChromosomeII
Putative gene structurejoin(729..834, 880..953, 1128..1299, 1471..1652, 2233..2577, 2900..3066, 3516..3596, 3646..3821, 3944..4177, 4577..4665, 4819..4929)
Map position-15.57
Balancer
Map position of balancer
Sequence of primersExtFwd:CTATTCGAATGGTACCGGAG,ExtRev:CTGGCGTGGGCGAGGTAATT,IntFwd:ACCGGAGAGGTTATTACGCA,IntRev:GGTGGAAGCACATAAGCCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Herrera LA, Starr DA.
The E3 Ubiquitin Ligase MIB-1 Is Necessary To Form the Nuclear Halo in Caenorhabditis elegans Sperm.
G3 (Bethesda) 2018 8(7) 2465-2470 
[ PubMed ID = 29776970 ] [ RRC reference ]

Thivierge C, Makil N, Flamand M, Vasale JJ, Mello CC, Wohlschlegel J, Conte D Jr, Duchaine TF.
Tudor domain ERI-5 tethers an RNA-dependent RNA polymerase to DCR-1 to potentiate endo-RNAi.
Nat Struct Mol Biol 2011 19(1) 90-7 
[ PubMed ID = 22179787 ] [ RRC reference ]

Liu H, Wang X, Wang HD, Wu J, Ren J, Meng L, Wu Q, Dong H, Wu J, Kao TY, Ge Q, Wu ZX, Yuh CH, Shan G.
Escherichia coli noncoding RNAs can affect gene expression and physiology of Caenorhabditis elegans.
Nat Commun 2012 3 1073 
[ PubMed ID = 23011127 ] [ RRC reference ]

Zhuang JJ, Hunter CP.
Tissue specificity of Caenorhabditis elegans enhanced RNA interference mutants.
Genetics 2011 188(1) 235-7 
[ PubMed ID = 21385728 ] [ RRC reference ]

Conine CC, Moresco JJ, Gu W, Shirayama M, Conte D Jr, Yates JR 3rd, Mello CC.
Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans.
Cell 2013 155(7) 1532-44 
[ PubMed ID = 24360276 ] [ RRC reference ]

Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte D Jr, Pang K, Brownell DR, Harding S, Mitani S, Ruvkun G, Yates JR 3rd, Mello CC.
Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways.
Cell 2006 124(2) 343-54 
[ PubMed ID = 16439208 ] [ RRC reference ]