Mutants (Isolated)

tm1356

Allele Nametm1356
Sequence NameT14E8.3
CGC Namedop-3
Worm BaseAllele Name tm1356
CGC Name dop-3
Sequence T14E8.3
Phenotypehomozygous viable
Mutation site27857/27858-28329/28330 (472 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(23380..23408, 23458..23704, 23753..23932, 23988..24467, 24513..24639, 25078..25320, 25371..25444, 25486..25604, 25662..25726, 27723..27849, 27904..28022, 28280..28609, 28656..28745, 28804..28894, 28949..29120, 29418..29516, 29569..29733, 30923..31070, 31710..31861, 32573..32779))
Map position-2.78
Balancer
Map position of balancer
Sequence of primersIntFwd:ACTATCCCAGCCATGTCGCA,ExtFwd:GTTCCGGAAGGCATTTCGGA,ExtRev:TGCCGTAGCGTGGACTAGAA,IntRev:GAGCGAGCAAGAAGCTTACG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kimura KD, Fujita K, Katsura I.
Enhancement of odor avoidance regulated by dopamine signaling in Caenorhabditis elegans.
J. Neurosci. 2010 30(48) 16365-75 
[ PubMed ID = 21123582 ] [ RRC reference ]

Yamazoe-Umemoto A, Fujita K, Iino Y, Iwasaki Y, Kimura KD.
Modulation of different behavioral components by neuropeptide and dopamine signalings in non-associative odor learning of Caenorhabditis elegans.
Neurosci. Res. 2015 99 22-33 
[ PubMed ID = 26068898 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]