Mutants (Isolated)

tm1353

Allele Nametm1353
Sequence NameF30A10.1
CGC Namecalm-1
Worm BaseAllele Name tm1353
CGC Name calm-1
Sequence F30A10.1
Phenotypehomozygous viable. Dr. M. Driscoll: normal in regard to growth, locomotion, brood size. Dr. Y. Jin: no specific phenotype is found.
Mutation site2582/2583-3200/3201 (618 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(818..1035, 1330..1477, 2053..2205, 2814..2913, 2974..3290))
Map position3.77
Balancer
Map position of balancer
Sequence of primersIntRev:ATCAACCTAATTTGCCGTGC,ExtRev:CATGCGGAATGAAACACGCT,IntFwd:TTGATAGCCACGGTAGGATT,ExtFwd:CGCACATTCATTTGCGCGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chan JP, Sieburth D.
Localized sphingolipid signaling at presynaptic terminals is regulated by calcium influx and promotes recruitment of priming factors.
J. Neurosci. 2012 32(49) 17909-20 
[ PubMed ID = 23223309 ] [ RRC reference ]

Kim S, Sieburth D.
A Receptor Tyrosine Kinase Network Regulates Neuromuscular Function in Response to Oxidative Stress in Caenorhabditis elegans.
Genetics 2019 211(4) 1283-1295 
[ PubMed ID = 30782598 ] [ RRC reference ]