Mutants (Isolated)

tm1346

Allele Nametm1346
Sequence NameC49G7.11
CGC Namedjr-1.2
Worm BaseAllele Name tm1346
CGC Name djr-1.2
Sequence C49G7.11
Phenotypehomozygous viable
Mutation site26644/26645-TTGTACTTCATTATCGAAAAATACTTCAATTATCGAAAATACTTCAATTATCGAAAAAATGATTCCCAGCGATGCAAAGATTATGACCATTTTTTTATACGTTCCGACGACATTTTCGACAAAGAACACGGTCAAATAAATGATGAAGAAGTTTGCTAGAAAACTTGCACAAAAGCCGATTTTGGAGAAAATGTTAGCCAAAACCAATGACGCTACCATTTTTGATATATGTGTTCACGTTAAACAGTAATATAGTTTTTTGGGGTATGTATTATATACGTGTTGCTACATACGAAAAACAGGAAATTACAACAGAGATGCGTATTTTCCTCGAGAAAACAGTGTCTGTTCTTATTCGTTTATATTACTTTTCCTGT-27679/27680 (1035 bp deletion + 378 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(26442..26599, 26701..26971, 27229..27360))
Map position-6.77
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTCCCTCCAGTGTTTCGAC,ExtRev:TCACCGAATACCGAGCGTCA,IntFwd:GTCGCTGATAACAACGTTGT,IntRev:ATGGAGGATCTTTGGTGCGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Johnson WM, Golczak M, Choe K, Curran PL, Miller OG, Yao C, Wang W, Lin J, Milkovic NM, Ray A, Ravindranath V, Zhu X, Wilson MA, Wilson-Delfosse AL, Chen SG, Mieyal JJ.
Regulation of DJ-1 by Glutaredoxin 1 in Vivo: Implications for Parkinson's Disease.
Biochemistry 2016 55(32) 4519-32 
[ PubMed ID = 26894491 ] [ RRC reference ]

Cooper JF, Machiela E, Dues DJ, Spielbauer KK, Senchuk MM, Van Raamsdonk JM.
Activation of the mitochondrial unfolded protein response promotes longevity and dopamine neuron survival in Parkinson's disease models.
Sci Rep 2017 7(1) 16441 
[ PubMed ID = 29180793 ] [ RRC reference ]

Cornejo Castro EM, Waak J, Weber SS, Fiesel FC, Oberhettinger P, Sch├╝tz M, Autenrieth IB, Springer W, Kahle PJ.
Parkinson's disease-associated DJ-1 modulates innate immunity signaling in Caenorhabditis elegans.
J Neural Transm (Vienna) 2010 117(5) 599-604 
[ PubMed ID = 20376509 ] [ RRC reference ]

Lee JY, Kim C, Kim J, Park C.
DJR-1.2 of Caenorhabditis elegans is induced by DAF-16 in the dauer state.
Gene 2013 524(2) 373-6 
[ PubMed ID = 23624124 ] [ RRC reference ]

Chen P, DeWitt MR, Bornhorst J, Soares FA, Mukhopadhyay S, Bowman AB, Aschner M.
Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease.
Metallomics 2015 7(2) 289-98 
[ PubMed ID = 25531510 ] [ RRC reference ]

Lee JY, Song J, Kwon K, Jang S, Kim C, Baek K, Kim J, Park C.
Human DJ-1 and its homologs are novel glyoxalases.
Hum. Mol. Genet. 2012 21(14) 3215-25 
[ PubMed ID = 22523093 ] [ RRC reference ]