Mutants (Isolated)

tm1336

Allele Nametm1336
Sequence NameT26C11.7
CGC Nameceh-39
Worm BaseAllele Name tm1336
CGC Name ceh-39
Sequence T26C11.7
Phenotypehomozygous viable
Mutation site19332/19333-19843/19844 (511 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (18926..19181,19353..19923,19974..20076, 20128..20397))
Map position-15.77
Balancer
Map position of balancer
Sequence of primersIntRev:CCGTGCGCTATTTAGGTGCA,ExtRev:ACCTCTTGTCTCCGTGCGCT,IntFwd:TAGCGTACACCGTATTGAGT,ExtFwd:GACCTGTGAGACTGTGAGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]