Mutants (Isolated)

tm1332

Allele Nametm1332
Sequence NameT22H9.3
CGC Namewago-10
Worm BaseAllele Name tm1332
CGC Name wago-10
Sequence T22H9.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site14521/14522-14918/14919 (397 bp deletion)
ChromosomeV
Putative gene structurejoin(14016..14133, 14190..14394, 14835..15668, 15717..16235, 16321..17266, 17585..17775, 17825..17984)
Map position-20
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCCCCGTGAGAGACTCAGA,ExtFwd:CAGTACAATTGTGGGTCCAA,IntRev:CGAGACCACCAGTGGCATTT,ExtRev:CCCGGAGCAACTTGCAGCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E, Ketting RF.
Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.
EMBO J 2012 31(16) 3422-30 
[ PubMed ID = 22850670 ] [ RRC reference ]