Mutants (Isolated)

tm1329

Allele Nametm1329
Sequence NameF15B10.2
CGC Namedrh-1
Worm BaseAllele Name tm1329
CGC Name drh-1
Sequence F15B10.2
Phenotypehomozygous viable. Dr. R. Plasterk: extracts are proficient for in vitro Dicer activity. Dr. S. Boulton: not required for FCD-2 focus formation after CDDP. Dr. R. Lu: PLoS Pathogens 5, e1000286 (2009).
Mutation site10039/10040-GGGAATACCGTAT-10522/10523 (483 bp deletion + 13 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(5544..5684, 5737..5795, 5859..5946, 5998..6324, 6378..6667, 6715..6924, 6971..7094, 8576..8787, 8831..8935, 9003..9233, 9282..9409, 9459..9547, 9598..9678, 9721..9887, 9944..10032, 10362..10482, 10541..10860, 10911..10977, 11022..11196, 11246..11335))
Map position3.21
Balancer
Map position of balancer
Sequence of primersIntRev:ATACTCTGCCTCGAGCCGAT,ExtRev:CTCAGCTGTCAGCAAGCGTG,IntFwd:GCTAGCCGCCTGTTGATTCA,ExtFwd:TCTAGACTCATCGTCGAGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Long T, Meng F, Lu R.
Transgene-Assisted Genetic Screen Identifies rsd-6 and Novel Genes as Key Components of Antiviral RNA Interference in Caenorhabditis elegans.
J. Virol. 2018 92(17)  
[ PubMed ID = 29950414 ] [ RRC reference ]

Guo X, Zhang R, Wang J, Ding SW, Lu R.
Homologous RIG-I-like helicase proteins direct RNAi-mediated antiviral immunity in C. elegans by distinct mechanisms.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(40) 16085-90 
[ PubMed ID = 24043766 ] [ RRC reference ]

Guo X, Zhang R, Wang J, Lu R.
Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.
J. Virol. 2013 87(19) 10721-9 
[ PubMed ID = 23885080 ] [ RRC reference ]

Thivierge C, Makil N, Flamand M, Vasale JJ, Mello CC, Wohlschlegel J, Conte D Jr, Duchaine TF.
Tudor domain ERI-5 tethers an RNA-dependent RNA polymerase to DCR-1 to potentiate endo-RNAi.
Nat. Struct. Mol. Biol. 2011 19(1) 90-7 
[ PubMed ID = 22179787 ] [ RRC reference ]

Juang BT, Gu C, Starnes L, Palladino F, Goga A, Kennedy S, L'Etoile ND.
Endogenous nuclear RNAi mediates behavioral adaptation to odor.
Cell 2013 154(5) 1010-1022 
[ PubMed ID = 23993094 ] [ RRC reference ]

Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34 
[ PubMed ID = 20223951 ] [ RRC reference ]

Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog. 2009 5(2) e1000286 
[ PubMed ID = 19197349 ] [ RRC reference ]