Mutants (Isolated)

tm1325

Allele Nametm1325
Sequence NameC09B7.1
CGC Nameser-7
Worm BaseAllele Name tm1325
CGC Name ser-7
Sequence C09B7.1
Phenotypehomozygous viable. Dr. R. Komuniecki: Genetics in press, Dr. K. Ashrafi: Cell Metab 7, 533 (2008).
Mutation site42634/42635-GGGAANNAAAACCCTCCCTNNANNANNATNNGGANNCC-43376/43377 (742 bp deletion + 38 bp insertion)
ChromosomeX
Putative gene structurejoin(36058..36389, 37087..37342, 40604..40933, 42388..42560, 43169..43306, 44163..44201, 44465..44504)
Map position-14.04
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGGATTCTCTATCAATAG,ExtFwd:GGCCTGCCTTCCTGACATGT,IntFwd:ATCCTGGAGCTGGCGAGTTA,ExtRev:GACTGTAAACGCGCAGAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Petrascheck M, Ye X, Buck LB.
An antidepressant that extends lifespan in adult Caenorhabditis elegans.
Nature 2007 450(7169) 553-6 
[ PubMed ID = 18033297 ] [ RRC reference ]

Weeks JC, Roberts WM, Leasure C, Suzuki BM, Robinson KJ, Currey H, Wangchuk P, Eichenberger RM, Saxton AD, Bird TD, Kraemer BC, Loukas A, Hawdon JM, Caffrey CR, Liachko NF.
Sertraline, Paroxetine, and Chlorpromazine Are Rapidly Acting Anthelmintic Drugs Capable of Clinical Repurposing.
Sci Rep 2018 8(1) 975 
[ PubMed ID = 29343694 ] [ RRC reference ]

Tatum MC, Ooi FK, Chikka MR, Chauve L, Martinez-Velazquez LA, Steinbusch HWM, Morimoto RI, Prahlad V.
Neuronal serotonin release triggers the heat shock response in C. elegans in the absence of temperature increase.
Curr. Biol. 2015 25(2) 163-174 
[ PubMed ID = 25557666 ] [ RRC reference ]

Gubert P, Aguiar GC, Mourão T, Bridi JC, Barros AG, Soares FA, Romano-Silva MA.
Behavioral and metabolic effects of the atypical antipsychotic ziprasidone on the nematode Caenorhabditis elegans.
PLoS ONE 2013 8(9) e74780 
[ PubMed ID = 24069346 ] [ RRC reference ]

Song BM, Faumont S, Lockery S, Avery L.
Recognition of familiar food activates feeding via an endocrine serotonin signal in Caenorhabditis elegans.
Elife 2013 2 e00329 
[ PubMed ID = 23390589 ] [ RRC reference ]

Donohoe DR, Jarvis RA, Weeks K, Aamodt EJ, Dwyer DS.
Behavioral adaptation in C. elegans produced by antipsychotic drugs requires serotonin and is associated with calcium signaling and calcineurin inhibition.
Neurosci. Res. 2009 64(3) 280-9 
[ PubMed ID = 19447297 ] [ RRC reference ]

Lucanic M, Garrett T, Yu I, Calahorro F, Asadi Shahmirzadi A, Miller A, Gill MS, Hughes RE, Holden-Dye L, Lithgow GJ.
Chemical activation of a food deprivation signal extends lifespan.
Aging Cell 2016 15(5) 832-41 
[ PubMed ID = 27220516 ] [ RRC reference ]

Carre-Pierrat M, Baillie D, Johnsen R, Hyde R, Hart A, Granger L, Ségalat L.
Characterization of the Caenorhabditis elegans G protein-coupled serotonin receptors.
Invert. Neurosci. 2006 6(4) 189-205 
[ PubMed ID = 17082916 ] [ RRC reference ]

Hobson RJ, Hapiak VM, Xiao H, Buehrer KL, Komuniecki PR, Komuniecki RW.
SER-7, a Caenorhabditis elegans 5-HT7-like receptor, is essential for the 5-HT stimulation of pharyngeal pumping and egg laying.
Genetics 2006 172(1) 159-69 
[ PubMed ID = 16204223 ] [ RRC reference ]

Srinivasan S, Sadegh L, Elle IC, Christensen AG, Faergeman NJ, Ashrafi K.
Serotonin regulates C. elegans fat and feeding through independent molecular mechanisms.
Cell Metab. 2008 7(6) 533-44 
[ PubMed ID = 18522834 ] [ RRC reference ]

You YJ, Kim J, Raizen DM, Avery L.
Insulin, cGMP, and TGF-beta signals regulate food intake and quiescence in C. elegans: a model for satiety.
Cell Metab. 2008 7(3) 249-57 
[ PubMed ID = 18316030 ] [ RRC reference ]

Bayer EA, Hobert O.
Past experience shapes sexually dimorphic neuronal wiring through monoaminergic signalling.
Nature 2018 561(7721) 117-121 
[ PubMed ID = 30150774 ] [ RRC reference ]

Stern S, Kirst C, Bargmann CI.
Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development.
Cell 2017 171(7) 1649-1662.e10 
[ PubMed ID = 29198526 ] [ RRC reference ]

Gomez-Amaro RL, Valentine ER, Carretero M, LeBoeuf SE, Rangaraju S, Broaddus CD, Solis GM, Williamson JR, Petrascheck M.
Measuring Food Intake and Nutrient Absorption in Caenorhabditis elegans.
Genetics 2015 200(2) 443-54 
[ PubMed ID = 25903497 ] [ RRC reference ]

Anderson A, Laurenson-Schafer H, Partridge FA, Hodgkin J, McMullan R.
Serotonergic chemosensory neurons modify the C. elegans immune response by regulating G-protein signaling in epithelial cells.
PLoS Pathog. 2013 9(12) e1003787 
[ PubMed ID = 24348250 ] [ RRC reference ]

Song BM, Avery L.
Serotonin activates overall feeding by activating two separate neural pathways in Caenorhabditis elegans.
J. Neurosci. 2012 32(6) 1920-31 
[ PubMed ID = 22323705 ] [ RRC reference ]

Wang Y, Tang L, Feng X, Du W, Liu BF.
Ethanol interferes with gustatory plasticity in Caenorhabditis elegans.
Neurosci. Res. 2011 71(4) 341-7 
[ PubMed ID = 21889959 ] [ RRC reference ]

Anyanful A, Easley KA, Benian GM, Kalman D.
Conditioning protects C. elegans from lethal effects of enteropathogenic E. coli by activating genes that regulate lifespan and innate immunity.
Cell Host Microbe 2009 5(5) 450-62 
[ PubMed ID = 19454349 ] [ RRC reference ]

Ward A, Walker VJ, Feng Z, Xu XZ.
Cocaine modulates locomotion behavior in C. elegans.
PLoS ONE 2009 4(6) e5946 
[ PubMed ID = 19536276 ] [ RRC reference ]

Lee KS, Iwanir S, Kopito RB, Scholz M, Calarco JA, Biron D, Levine E.
Serotonin-dependent kinetics of feeding bursts underlie a graded response to food availability in C. elegans.
Nat Commun 2017 8 14221 
[ PubMed ID = 28145493 ] [ RRC reference ]