Mutants (Isolated)

tm1325

Allele Nametm1325
Sequence NameC09B7.1
CGC Nameser-7
Worm BaseAllele Name tm1325
CGC Name ser-7
Sequence C09B7.1
Phenotypehomozygous viable. Dr. R. Komuniecki: Genetics in press, Dr. K. Ashrafi: Cell Metab 7, 533 (2008).
Mutation site42634/42635-GGGAANNAAAACCCTCCCTNNANNANNATNNGGANNCC-43376/43377 (742 bp deletion + 38 bp insertion)
ChromosomeX
Putative gene structurejoin(36058..36389, 37087..37342, 40604..40933, 42388..42560, 43169..43306, 44163..44201, 44465..44504)
Map position-14.04
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGGATTCTCTATCAATAG,ExtFwd:GGCCTGCCTTCCTGACATGT,IntFwd:ATCCTGGAGCTGGCGAGTTA,ExtRev:GACTGTAAACGCGCAGAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weeks JC, Roberts WM, Leasure C, Suzuki BM, Robinson KJ, Currey H, Wangchuk P, Eichenberger RM, Saxton AD, Bird TD, Kraemer BC, Loukas A, Hawdon JM, Caffrey CR, Liachko NF.
Sertraline, Paroxetine, and Chlorpromazine Are Rapidly Acting Anthelmintic Drugs Capable of Clinical Repurposing.
Sci Rep 2018 8(1) 975 
[ PubMed ID = 29343694 ] [ RRC reference ]

Lucanic M, Garrett T, Yu I, Calahorro F, Asadi Shahmirzadi A, Miller A, Gill MS, Hughes RE, Holden-Dye L, Lithgow GJ.
Chemical activation of a food deprivation signal extends lifespan.
Aging Cell 2016 15(5) 832-41 
[ PubMed ID = 27220516 ] [ RRC reference ]

Bayer EA, Hobert O.
Past experience shapes sexually dimorphic neuronal wiring through monoaminergic signalling.
Nature 2018 561(7721) 117-121 
[ PubMed ID = 30150774 ] [ RRC reference ]

Alam T, Maruyama H, Li C, Pastuhov SI, Nix P, Bastiani M, Hisamoto N, Matsumoto K.
Axotomy-induced HIF-serotonin signalling axis promotes axon regeneration in C. elegans.
Nat Commun 2016 7 10388 
[ PubMed ID = 26790951 ] [ RRC reference ]

Lee KS, Iwanir S, Kopito RB, Scholz M, Calarco JA, Biron D, Levine E.
Serotonin-dependent kinetics of feeding bursts underlie a graded response to food availability in C. elegans.
Nat Commun 2017 8 14221 
[ PubMed ID = 28145493 ] [ RRC reference ]

Oakes M, Law WJ, Komuniecki R.
Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans.
J. Neurosci. 2019 39(21) 4142-4152 
[ PubMed ID = 30886012 ] [ RRC reference ]

Stern S, Kirst C, Bargmann CI.
Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development.
Cell 2017 171(7) 1649-1662.e10 
[ PubMed ID = 29198526 ] [ RRC reference ]

Song BM, Faumont S, Lockery S, Avery L.
Recognition of familiar food activates feeding via an endocrine serotonin signal in Caenorhabditis elegans.
Elife 2013 2 e00329 
[ PubMed ID = 23390589 ] [ RRC reference ]

Gubert P, Aguiar GC, MourĂ£o T, Bridi JC, Barros AG, Soares FA, Romano-Silva MA.
Behavioral and metabolic effects of the atypical antipsychotic ziprasidone on the nematode Caenorhabditis elegans.
PLoS ONE 2013 8(9) e74780 
[ PubMed ID = 24069346 ] [ RRC reference ]

Tatum MC, Ooi FK, Chikka MR, Chauve L, Martinez-Velazquez LA, Steinbusch HWM, Morimoto RI, Prahlad V.
Neuronal serotonin release triggers the heat shock response in C. elegans in the absence of temperature increase.
Curr. Biol. 2015 25(2) 163-174 
[ PubMed ID = 25557666 ] [ RRC reference ]

Wang Y, Tang L, Feng X, Du W, Liu BF.
Ethanol interferes with gustatory plasticity in Caenorhabditis elegans.
Neurosci. Res. 2011 71(4) 341-7 
[ PubMed ID = 21889959 ] [ RRC reference ]

Song BM, Avery L.
Serotonin activates overall feeding by activating two separate neural pathways in Caenorhabditis elegans.
J. Neurosci. 2012 32(6) 1920-31 
[ PubMed ID = 22323705 ] [ RRC reference ]

Anderson A, Laurenson-Schafer H, Partridge FA, Hodgkin J, McMullan R.
Serotonergic chemosensory neurons modify the C. elegans immune response by regulating G-protein signaling in epithelial cells.
PLoS Pathog. 2013 9(12) e1003787 
[ PubMed ID = 24348250 ] [ RRC reference ]

Gomez-Amaro RL, Valentine ER, Carretero M, LeBoeuf SE, Rangaraju S, Broaddus CD, Solis GM, Williamson JR, Petrascheck M.
Measuring Food Intake and Nutrient Absorption in Caenorhabditis elegans.
Genetics 2015 200(2) 443-54 
[ PubMed ID = 25903497 ] [ RRC reference ]

Zhang Q, Wu X, Chen P, Liu L, Xin N, Tian Y, Dillin A.
The Mitochondrial Unfolded Protein Response Is Mediated Cell-Non-autonomously by Retromer-Dependent Wnt Signaling.
Cell 2018 174(4) 870-883.e17 
[ PubMed ID = 30057120 ] [ RRC reference ]

Rangaraju S, Solis GM, Thompson RC, Gomez-Amaro RL, Kurian L, Encalada SE, Niculescu AB 3rd, Salomon DR, Petrascheck M.
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality.
Elife 2015 4 e08833 
[ PubMed ID = 26623667 ] [ RRC reference ]

Govorunova EG, Moussaif M, Kullyev A, Nguyen KC, McDonald TV, Hall DH, Sze JY.
A homolog of FHM2 is involved in modulation of excitatory neurotransmission by serotonin in C. elegans.
PLoS ONE 2010 5(4) e10368 
[ PubMed ID = 20442779 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J. Neurosci. 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Cunningham KA, Hua Z, Srinivasan S, Liu J, Lee BH, Edwards RH, Ashrafi K.
AMP-activated kinase links serotonergic signaling to glutamate release for regulation of feeding behavior in C. elegans.
Cell Metab. 2012 16(1) 113-21 
[ PubMed ID = 22768843 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS ONE 2011 6(7) e21897 
[ PubMed ID = 21814562 ] [ RRC reference ]