Mutants (Isolated)

tm1310

Allele Nametm1310
Sequence NameC16A3.8
CGC Namethoc-2
Worm BaseAllele Name tm1310
CGC Name thoc-2
Sequence C16A3.8
Phenotypelethal or sterile
Mutation site1472/1473-2161/2162 (689 bp deletion)
ChromosomeIII
Putative gene structurejoin(45..140, 189..320, 522..613, 660..879, 1100..1282, 1333..1485, 1534..2038, 2267..2668, 2874..3801, 3850..3958, 4001..4139, 4188..5047, 5103..5483, 5550..5771)
Map position-1.35
BalancerhT2
Map position of balancer
Sequence of primersIntRev:TTCCAAGAGCTTGCAGCCAA,ExtFwd:GCTTATGGAAGCAGCCGAGA,IntFwd:GCTCAGCGAATGAGAATGAA,ExtRev:GAGATCCAACCAGTGTTCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Castellano-Pozo M, García-Muse T, Aguilera A.
The Caenorhabditis elegans THO complex is required for the mitotic cell cycle and development.
PLoS One 2012 7(12) e52447 
[ PubMed ID = 23285047 ] [ RRC reference ]

Castellano-Pozo M, García-Muse T, Aguilera A.
R-loops cause replication impairment and genome instability during meiosis.
EMBO Rep 2012 13(10) 923-9 
[ PubMed ID = 22878416 ] [ RRC reference ]

Castellano-Pozo M, Santos-Pereira JM, Rondón AG, Barroso S, Andújar E, Pérez-Alegre M, García-Muse T, Aguilera A.
R loops are linked to histone H3 S10 phosphorylation and chromatin condensation.
Mol Cell 2013 52(4) 583-90 
[ PubMed ID = 24211264 ] [ RRC reference ]