Mutants (Isolated)

tm1305

Allele Nametm1305
Sequence NameC27F2.2
CGC Namenca-2
Worm BaseAllele Name tm1305
CGC Name nca-2
Sequence C27F2.2
Phenotypehomozygous viable
Mutation site17830/17831-18624/18625 (794 bp deletion)
ChromosomeIII
Putative gene structurejoin(8279..8306, 12829..12999, 13917..14245, 14322..14434, 14513..14933, 15171..15365, 15419..15662, 16126..16376, 16485..16622, 16671..16956, 17376..17766, 17818..17994, 18046..18181, 18330..18461, 18512..18679, 18980..19312, 19434..19947, 20185..20437, 20493..20722, 20985..21258, 21320..21482, 21532..21699, 21952..22194)
Map position-2.29
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCGATCAATGTTATCCGGT,IntFwd:CCGGTAGAGGACCATCTAAA,IntRev:GTCGTCAGATCATAGAGGTA,ExtRev:TTGAACCATCGAGACGTCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Humphrey JA, Hamming KS, Thacker CM, Scott RL, Sedensky MM, Snutch TP, Morgan PG, Nash HA.
A putative cation channel and its novel regulator: cross-species conservation of effects on general anesthesia.
Curr. Biol. 2007 17(7) 624-9 
[ PubMed ID = 17350263 ] [ RRC reference ]