Mutants (Isolated)

tm1298

Allele Nametm1298
Sequence NameY41E3.9
CGC Namefcd-2
Worm BaseAllele Name tm1298
CGC Name fcd-2
Sequence Y41E3.9
Phenotypehomozygous viable. Dr. H-S. Koo: bag of worms, slow larval growth. Early embryos are slightly more sensitive to ionizing radiation but germ cells show higher resistance to ionizing radiation. Dr. S. Boulton: DNA repair in press. Dr. H-S. Koo: BBRC 352, 479 (2007).
Mutation site81469/81470-81706/81707 (237 bp deletion)
ChromosomeIV
Putative gene structurejoin(75699..76652, 77499..77630, 79122..79749, 80673..81104, 81682..82102, 82676..82737, 82789..82942, 83342..83607, 84270..84940, 86000..86200)
Map position12.83
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGGGAGTTGAGACGCGTAT,IntRev:CAGCTAACAACATTGGTGGT,ExtRev:GTCCGCCCCAAATCACCTCA,IntFwd:CCTGACTCCACATGCCACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee KY, Yang I, Park JE, Baek OR, Chung KY, Koo HS.
Developmental stage- and DNA damage-specific functions of C. elegans FANCD2.
Biochem. Biophys. Res. Commun. 2007 352(2) 479-85 
[ PubMed ID = 17126808 ] [ RRC reference ]

Adamo A, Woglar A, Silva N, Penkner A, Jantsch V, La Volpe A.
Transgene-mediated cosuppression and RNA interference enhance germ-line apoptosis in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(9) 3440-5 
[ PubMed ID = 22331911 ] [ RRC reference ]

Lee H, Alpi AF, Park MS, Rose A, Koo HS.
C. elegans ring finger protein RNF-113 is involved in interstrand DNA crosslink repair and interacts with a RAD51C homolog.
PLoS ONE 2013 8(3) e60071 
[ PubMed ID = 23555887 ] [ RRC reference ]

Adamo A, Collis SJ, Adelman CA, Silva N, Horejsi Z, Ward JD, Martinez-Perez E, Boulton SJ, La Volpe A.
Preventing nonhomologous end joining suppresses DNA repair defects of Fanconi anemia.
Mol. Cell 2010 39(1) 25-35 
[ PubMed ID = 20598602 ] [ RRC reference ]

Collis SJ, Barber LJ, Ward JD, Martin JS, Boulton SJ.
C. elegans FANCD2 responds to replication stress and functions in interstrand cross-link repair.
DNA Repair (Amst.) 2006 5(11) 1398-406 
[ PubMed ID = 16914393 ] [ RRC reference ]

Youds JL, Barber LJ, Ward JD, Collis SJ, O'Neil NJ, Boulton SJ, Rose AM.
DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair.
Mol. Cell. Biol. 2008 28(5) 1470-9 
[ PubMed ID = 18086896 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ. 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]

Lee KY, Chung KY, Koo HS.
The involvement of FANCM, FANCI, and checkpoint proteins in the interstrand DNA crosslink repair pathway is conserved in C. elegans.
DNA Repair (Amst.) 2010 9(4) 374-82 
[ PubMed ID = 20075016 ] [ RRC reference ]

Youds JL, Barber LJ, Boulton SJ.
C. elegans: a model of Fanconi anemia and ICL repair.
Mutat. Res. 2009 668(1-2) 103-16 
[ PubMed ID = 19059419 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst.) 2008 7(6) 941-50 
[ PubMed ID = 18472307 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]