Mutants (Isolated)

tm1291

Allele Nametm1291
Sequence NameF25B4.9
CGC Nameclec-1
Worm BaseAllele Name tm1291
CGC Name clec-1
Sequence F25B4.9
Phenotypehomozygous viable. Dr. O. Hobert: no defects in axon patterning at ventral midline (PVQ axons examined).
Mutation site21611/21612-TTCGT-21946/21947 (335 bp deletion + 5 bp insertion)
ChromosomeV
Putative gene structurejoin(21726..21774, 21830..21905, 21958..22273, 22324..22404)
Map position-1.2
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGCATTGAGGCGCCTAATT,ExtRev:GCCGGAAATCGCCAGTGTGT,IntFwd:CCGGTTTCCTAACTTGAGGT,IntRev:ATTTAAGAGCGGTGACGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ihara S, Hagedorn EJ, Morrissey MA, Chi Q, Motegi F, Kramer JM, Sherwood DR.
Basement membrane sliding and targeted adhesion remodels tissue boundaries during uterine-vulval attachment in Caenorhabditis elegans.
Nat. Cell Biol. 2011 13(6) 641-51 
[ PubMed ID = 21572423 ] [ RRC reference ]