Mutants (Isolated)

tm1276

Allele Nametm1276
BalanceNot Required
OutCrossNot Accepted
Sequence NameF02E9.4
Gene Namesin-3
Worm BaseAllele Name tm1276
Gene Name sin-3
Sequence F02E9.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Satterlee: reduced brood size, more severe at 25 degree. Prodruded vulva. Dr. K.L. Chow: truncated protein of 233 aa. Ray patterning defects (fusion), protruding vulva and slightly small animal. Dr. J. Ahringer: non-Pvl. Dr. M. Han: suppress synMuv. Dr. M. Peter: does not suppress par-2 (RNAi).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13398/13399-13713/13714 (315 bp deletion)
ChromosomeI
Putative gene structurejoin(12437..13111, 13500..13786, 14056..14212, 14325..14627, 15027..15461, 15953..16087, 16134..16232, 16559..16951, 17002..17121, 17190..17290, 17484..17672, 17721..17864, 18263..18412, 18465..18551, 18601..18862, 19145..19258, 19307..19705, 19764..19892, 20090..20311, 20354..20470)
Map position2.83
Balancer
Map position of balancer
Sequence of primersExtFwd:GTTCAAGCAGCTCAGGCACA,IntFwd:TACCATCTCATTCACCGGCA,ExtRev:TCGGGCGAGCCAGAAACGAT,IntRev:TCGCTACAGTAAACACTCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Taylor CA, Maor-Nof M, Metzl-Raz E, Hidalgo A, Yee C, Gitler AD, Shen K.
Histone deacetylase inhibition expands cellular proteostasis repertoires to enhance neuronal stress resilience.
bioRxiv 2024   
[ PubMed ID = 39229034 ] [ RRC reference ]

Giovannetti M, Rodríguez-Palero MJ, Fabrizio P, Nicolle O, Bedet C, Michaux G, Witting M, Artal-Sanz M, Palladino F.
SIN-3 transcriptional coregulator maintains mitochondrial homeostasis and polyamine flux.
iScience 2024 27(5) 109789 
[ PubMed ID = 38746662 ] [ RRC reference ]

Robert VJ, Caron M, Gely L, Adrait A, Pakulska V, Couté Y, Chevalier M, Riedel CG, Bedet C, Palladino F.
SIN-3 acts in distinct complexes to regulate the germline transcriptional program in Caenorhabditis elegans.
Development 2023 150(21)  
[ PubMed ID = 37818613 ] [ RRC reference ]

Kim H, Ding YH, Zhang G, Yan YH, Conte D Jr, Dong MQ, Mello CC.
HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans.
Elife 2021 10  
[ PubMed ID = 34003109 ] [ RRC reference ]

McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]

Beurton F, Stempor P, Caron M, Appert A, Dong Y, Chen RA, Cluet D, Couté Y, Herbette M, Huang N, Polveche H, Spichty M, Bedet C, Ahringer J, Palladino F.
Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans.
Nucleic Acids Res 2019 47(21) 11164-11180 
[ PubMed ID = 31602465 ] [ RRC reference ]

Müthel S, Uyar B, He M, Krause A, Vitrinel B, Bulut S, Vasiljevic D, Marchal I, Kempa S, Akalin A, Tursun B.
The conserved histone chaperone LIN-53 is required for normal lifespan and maintenance of muscle integrity in Caenorhabditis elegans.
Aging Cell 2019 18(6) e13012 
[ PubMed ID = 31397537 ] [ RRC reference ]

Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K.
A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes.
Elife 2019 8  
[ PubMed ID = 31386623 ] [ RRC reference ]

Pokhrel B, Chen Y, Biro JJ.
CFP-1 interacts with HDAC1/2 complexes in C. elegans development.
FEBS J 2019 286(13) 2490-2504 
[ PubMed ID = 30941832 ] [ RRC reference ]

Hajduskova M, Baytek G, Kolundzic E, Gosdschan A, Kazmierczak M, Ofenbauer A, Beato Del Rosal ML, Herzog S, Ul Fatima N, Mertins P, Seelk-Müthel S, Tursun B.
MRG-1/MRG15 Is a Barrier for Germ Cell to Neuron Reprogramming in Caenorhabditis elegans.
Genetics 2019 211(1) 121-139 
[ PubMed ID = 30425042 ] [ RRC reference ]

Nomoto Y, Kubota Y, Ohnishi Y, Kasahara K, Tomita A, Oshime T, Yamashita H, Fahmi M, Ito M.
Gene Cascade Finder: A tool for identification of gene cascades and its application in Caenorhabditis elegans.
PLoS One 2019 14(9) e0215187 
[ PubMed ID = 31504044 ] [ RRC reference ]

Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet 2011 7(9) e1002267 
[ PubMed ID = 21909284 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Choy SW, Wong YM, Ho SH, Chow KL.
C. elegans SIN-3 and its associated HDAC corepressor complex act as mediators of male sensory ray development.
Biochem Biophys Res Commun 2007 358(3) 802-7 
[ PubMed ID = 17506990 ] [ RRC reference ]