Mutants (Isolated)

tm1267

Allele Nametm1267
Sequence NameY81G3A.3
CGC Namegcn-2
Worm BaseAllele Name tm1267
CGC Name gcn-2
Sequence Y81G3A.3
Phenotypehomozygous viable
Mutation site5189/5190-5722/5723 (533 bp deletion)
ChromosomeII
Putative gene structurejoin(4322..4450, 4499..4855, 4929..5090, 5198..5797, 5857..5998, 6050..8184, 8236..8410, 8461..9149, 10038..10300, 10351..10624, 11050..11214)
Map position14.63
Balancer
Map position of balancer
Sequence of primersIntRev:CAGCCCAAGCATAGTAGTAT,IntFwd:TCTTATTCCCAGGGCCCCAT,ExtRev:GCGAGGAATCATCATCAGAC,ExtFwd:CCTACGACACTTTGCGGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nukazuka A, Fujisawa H, Inada T, Oda Y, Takagi S.
Semaphorin controls epidermal morphogenesis by stimulating mRNA translation via eIF2alpha in Caenorhabditis elegans.
Genes Dev. 2008 22(8) 1025-36 
[ PubMed ID = 18413715 ] [ RRC reference ]