Mutants (Isolated)

tm1258

Allele Nametm1258
Sequence NameK03A11.3
CGC Nameceh-28
Worm BaseAllele Name tm1258
CGC Name ceh-28
Sequence K03A11.3
Phenotypelethal or sterile. Dr. L. Avery: Partial loss of M4 function, reduced feeding efficiency. Homozygous viable but slow-growing on E coli DA837. Grows better on E coli HB101 or Comamonas.
Mutation site22776/22777-23748/23749 (972 bp deletion)
ChromosomeX
Putative gene structurejoin(22884..23291, 23709..23804, 23849..23995)
Map position10.21
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntFwd:GAACTAGCTTAAAACTTACCA,IntRev:TGACTTTCTGAGTTAGCAGAT,ExtRev:GGTATCGCCTCCCACAACAT,ExtFwd:AGAATACATCGAGGGTAACC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ray P, Schnabel R, Okkema PG.
Behavioral and synaptic defects in C. elegans lacking the NK-2 homeobox gene ceh-28.
Dev Neurobiol 2008 68(4) 421-33 
[ PubMed ID = 18161854 ] [ RRC reference ]

Ramakrishnan K, Ray P, Okkema PG.
CEH-28 activates dbl-1 expression and TGF-β signaling in the C. elegans M4 neuron.
Dev. Biol. 2014 390(2) 149-59 
[ PubMed ID = 24690231 ] [ RRC reference ]