Mutants (Isolated)

tm1249

Allele Nametm1249
Sequence NameY105E8A.9
CGC Nameapg-1
Worm BaseAllele Name tm1249
CGC Name apg-1
Sequence Y105E8A.9
Phenotypelethal or sterile. Dr. S. L'Hernault: could not recover. Dr. O. Blacque: could not assess Dyf. Dr. G. Michaux: L1 Lvl.
Mutation site73118/73119-T-73558/73559 (440 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurejoin(72883..72944, 73007..73211, 73258..73382, 74182..74878, 76357..76617, 78685..79124, 80346..80690, 82302..82569, 84173..84259)
Map position25.7
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:CGATCGGGTACATGGAATGA,IntRev:AACGCACAGAGCGCCGCTTT,IntFwd:CGCAAGATGGTCACTGCGGA,ExtFwd:CAGCAGCCTCTGTGGTCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shafaq-Zadah M, Brocard L, Solari F, Michaux G.
AP-1 is required for the maintenance of apico-basal polarity in the C. elegans intestine.
Development 2012 139(11) 2061-70 
[ PubMed ID = 22535414 ] [ RRC reference ]