Mutants (Isolated)

tm1247

Allele Nametm1247
Sequence NameC05E11.1
CGC Namelnp-1
Worm BaseAllele Name tm1247
CGC Name lnp-1
Sequence C05E11.1
Phenotypehomozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C).
Mutation site33516/33517-34353/34354 (837 bp deletion)
ChromosomeX
Putative gene structurejoin(33191..33292, 33342..33614, 33670..33864, 34050..34171, 34227..34346, 34397..34613)
Map position-7.21
Balancer
Map position of balancer
Sequence of primersIntFwd:GTCAGTTGGAAATCTGGTGA,IntRev:CGGACGAGTCAACGGAATTT,ExtFwd:GCGCAACTGCACAACTGCAT,ExtRev:TCCATTGTGTTGAATGCCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ghila L, Gomez M.
The evolutionarily conserved gene LNP-1 is required for synaptic vesicle trafficking and synaptic transmission.
Eur. J. Neurosci. 2008 27(3) 621-30 
[ PubMed ID = 18279315 ] [ RRC reference ]

Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42 
[ PubMed ID = 23086219 ] [ RRC reference ]