Mutants (Isolated)

tm1246

Allele Nametm1246
Sequence NameZK430.3
CGC Namesod-5
Worm BaseAllele Name tm1246
CGC Name sod-5
Sequence ZK430.3
Phenotypehomozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site24062/24063-24523/24524 (461 bp deletion)
ChromosomeII
Putative gene structurejoin(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067)
Map position-4.69
Balancer
Map position of balancer
Sequence of primersIntRev:GATCGACGTGGACAACCATG,ExtRev:GGCCTTGTCGTCGATTCCCT,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtFwd:AATGGCGGAAGGATAGCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc. Natl. Acad. Sci. U.S.A. 2012 109(15) 5785-90 
[ PubMed ID = 22451939 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet. 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet. 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]