Mutants (Isolated)

tm1244

Allele Nametm1244
Sequence NameC23H3.1
CGC Nameegl-26
Worm BaseAllele Name tm1244
CGC Name egl-26
Sequence C23H3.1
Phenotypehomozygous viable. Dr. W. Hanna-Rose: Dev. Biol. 308, 196 (2007).
Mutation site25490/25491-26093/26094 (603 bp deletion)
ChromosomeII
Putative gene structurejoin(25054..25248, 25299..25653, 25879..26045, 26093..26329)
Map position-16.27
Balancer
Map position of balancer
Sequence of primersIntFwd:CAAGTACCCCCATTCAAACT,ExtFwd:CGATACAGCTACTCTACACA,ExtRev:CGTTGACGACAGTAGACGTT,IntRev:GTTTCAGTACTGTGCAAGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Estes KA, Kalamegham R, Hanna-Rose W.
Membrane localization of the NlpC/P60 family protein EGL-26 correlates with regulation of vulval cell morphogenesis in Caenorhabditis elegans.
Dev. Biol. 2007 308(1) 196-205 
[ PubMed ID = 17560977 ] [ RRC reference ]

Mitani S.
Nematode, an experimental animal in the national BioResource project.
Exp. Anim. 2009 58(4) 351-6 
[ PubMed ID = 19654432 ] [ RRC reference ]