Mutants (Isolated)

tm1243

Allele Nametm1243
Allele TypeNormal
Sequence NameT27D12.2a
Gene Nameclh-1
Worm BaseAllele Name tm1243
Gene Name clh-1
Sequence T27D12.2a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Shaham: no obvious defects in amphid function.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 20871/20872-21488/21489 (617 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(17737..17852, 17909..18092, 18156..18263, 18307..18369, 18600..18726, 18860..18904, 19301..19537, 19592..20230, 20741..20842, 20985..21201, 21245..21407, 21514..21647, 21698..21829, 21876..21995, 22041..22189, 23572..23660, 23725..23763))
Map position4.08
Balancer
Map position of balancer
Sequence of primersExtRev:TACGTGTGCGCCTATGCGAA,IntRev:AAGGCCTAGGCAACCGCAAT,IntFwd:CGGCGAAAATTGCAGCACAA,ExtFwd:ACCATTGGGGTAGACGAGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Park C, Sakurai Y, Sato H, Kanda S, Iino Y, Kunitomo H.
Roles of the ClC chloride channel CLH-1 in food-associated salt chemotaxis behavior of C. elegans.
Elife 2021 10  
[ PubMed ID = 33492228 ] [ RRC reference ]