Mutants (Isolated)

tm1238

Allele Nametm1238
Sequence NameF39H11.3
CGC Namecdk-8
Worm BaseAllele Name tm1238
CGC Name cdk-8
Sequence F39H11.3
Phenotypehomozygous viable. Dr. H. Sawa: Dpy, fertile, low brood size., 16%Psa, very weak Muv (2%). Dr. T. Schedl: could not maintain mutants. Dr. J. Kimble: homozygous viable and fertile. Dr. J. Lee: short body length. Dr. R. Mako Saito: Dev Biol 313, :603 (2008).
Mutation site8004/8005-8731/8732 (727 bp deletion)
ChromosomeI
Putative gene structurejoin(8040..8044, 8094..8333, 8458..8645, 8697..8793, 8843..8978, 9025..9146, 9197..9295, 9677..9836, 9885..10382, 10833..11156)
Map position3.01
Balancer
Map position of balancer
Sequence of primersExtRev:GCCCTTACCGTCATCTGCTG,IntRev:CGTCAGTCTCCCTTGGTGGT,ExtFwd:CCTGCCGTTTGCACATACGT,IntFwd:GTTCGGCGAGAATTTGCCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Clayton JE, van den Heuvel SJ, Saito RM.
Transcriptional control of cell-cycle quiescence during C. elegans development.
Dev. Biol. 2008 313(2) 603-13 
[ PubMed ID = 18082681 ] [ RRC reference ]

Underwood RS, Deng Y, Greenwald I.
Integration of EGFR and LIN-12/Notch Signaling by LIN-1/Elk1, the Cdk8 Kinase Module, and SUR-2/Med23 in Vulval Precursor Cell Fate Patterning in Caenorhabditis elegans.
Genetics 2017 207(4) 1473-1488 
[ PubMed ID = 28954762 ] [ RRC reference ]

Grants JM, Ying LT, Yoda A, You CC, Okano H, Sawa H, Taubert S.
The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans.
Genetics 2016 202(2) 583-99 
[ PubMed ID = 26715664 ] [ RRC reference ]

Lee K, Shim J, Lee J, Lee J.
Identification of genes interacting with rnt-1 through large-scale RNAi screening in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(10) 1779-84 
[ PubMed ID = 23979934 ] [ RRC reference ]

Ou CY, Poon VY, Maeder CI, Watanabe S, Lehrman EK, Fu AK, Park M, Fu WY, Jorgensen EM, Ip NY, Shen K.
Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components.
Cell 2010 141(5) 846-58 
[ PubMed ID = 20510931 ] [ RRC reference ]

Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H.
The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation.
Dev. Biol. 2013 377(2) 385-98 
[ PubMed ID = 23458898 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr. Biol. 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]