Mutants (Isolated)

tm1234

Allele Nametm1234
Sequence NameF58G11.1a
CGC Nameletm-1
Worm BaseAllele Name tm1234
CGC Name letm-1
Sequence F58G11.1a
Phenotypelethal or sterile. Dr. A. van der Bliek: Human Mol. Genetics 16, 2061 (2007).
Mutation site1561/1562-TTTTCAGGAAGAAAA-2098/2099 (537 bp deletion + 15 bp insertion)
ChromosomeV
Putative gene structurejoin(1449..1579, 1639..2059, 2108..2634, 2686..3730, 3780..3926, 4030..4113)
Map position5.57
BalancernT1
Map position of balancer
Sequence of primersExtFwd:CTGGCTTATGGGATCGTCAT,IntFwd:GTTTTAACTCCCGATTGCGA,ExtRev:CGCTGTTCTCCACGGTTGGA,IntRev:AGCGAATGCACCATCTAGAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hasegawa A, van der Bliek AM.
Inverse correlation between expression of the Wolfs Hirschhorn candidate gene Letm1 and mitochondrial volume in C. elegans and in mammalian cells.
Hum. Mol. Genet. 2007 16(17) 2061-71 
[ PubMed ID = 17606466 ] [ RRC reference ]