Allele Name | tm1233 |
Sequence Name | F42A6.9 |
CGC Name | elks-1 |
Worm Base | Allele Name |
tm1233
|
CGC Name |
elks-1
|
Sequence |
F42A6.9
|
Phenotype | homozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. HSN presynaptic components (syd-2, syd-1, GIT-1, SAD-1) localization normal. Dr. Y. Jin: same as reported by Denken et al.(2005). Dr. M. Zhen: no SYD-2::GFP localization defects in GABAergic neurons. Dr. C. Bargmann: locomotion OK, normal GFP::UNC-2 localization. |
Mutation site | 27776/27777-28341/28342 (565 bp deletion) |
Chromosome | IV |
Putative gene structure | complement(join(24955..25102, 25160..25275, 26060..26429, 26702..27734, 28115..28223, 28272..28460)) |
Map position | -4.61 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GCCTACCTGGGATGATACGA,IntRev:CTGGGATGATACGATGGTCT,ExtFwd:CTCGTCTCAGCTCATCGGTA,IntFwd:CAGCTCATCGGTACCCTTGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chia PH, Patel MR, Shen K. NAB-1 instructs synapse assembly by linking adhesion molecules and F-actin to active zone proteins. Nat Neurosci 2012 15(2) 234-42
[ PubMed ID = 22231427 ]
[ RRC reference ]
|
Patel MR, Shen K. RSY-1 is a local inhibitor of presynaptic assembly in C. elegans. Science 2009 323(5920) 1500-3
[ PubMed ID = 19286562 ]
[ RRC reference ]
|
Saheki Y, Bargmann CI. Presynaptic CaV2 calcium channel traffic requires CALF-1 and the alpha(2)delta subunit UNC-36. Nat Neurosci 2009 12(10) 1257-65
[ PubMed ID = 19718034 ]
[ RRC reference ]
|
Patel MR, Lehrman EK, Poon VY, Crump JG, Zhen M, Bargmann CI, Shen K. Hierarchical assembly of presynaptic components in defined C. elegans synapses. Nat Neurosci 2006 9(12) 1488-98
[ PubMed ID = 17115039 ]
[ RRC reference ]
|
|