Mutants (Isolated)

tm1229

Allele Nametm1229
Sequence NameF56A3.5
CGC Namebro-1
Worm BaseAllele Name tm1229
CGC Name bro-1
Sequence F56A3.5
Phenotypehomozygous viable
Mutation site17085/17086-TTTG-18090/18091 (1005 bp deletion + 4 bp insertion)
ChromosomeI
Putative gene structurejoin(15956..16120, 16553..16618, 17360..17587)
Map position-0.3
Balancer
Map position of balancer
Sequence of primersExtRev:CCGTTCAATTCACGAAGCAT,IntRev:GGACCTGCGAGTTGTAACAA,IntFwd:CCGACAACATTTGTCGGTGA,ExtFwd:TTCTTGTGACTCCGCCTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15 
[ PubMed ID = 17933794 ] [ RRC reference ]