Mutants (Isolated)

tm1220

Allele Nametm1220
Sequence NameZK652.11
CGC Namecuc-1
Worm BaseAllele Name tm1220
CGC Name cuc-1
Sequence ZK652.11
Phenotypehomozygous viable
Mutation site33170/33171-33494/33495 (324 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(32409..32536, 32583..32655, 32735..32743))
Map position-0.54
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCTCTTTCCGCCATGAGTC,ExtRev:TGCAGACTGCGTATGCGACA,ExtFwd:GCAATCCAATGGGGATTCGT,IntRev:GCGACACCATACTTGACGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fields BD, Kennedy S.
Chromatin Compaction by Small RNAs and the Nuclear RNAi Machinery in C. elegans.
Sci Rep 2019 9(1) 9030 
[ PubMed ID = 31227740 ] [ RRC reference ]

Yeon J, Kim J, Kim DY, Kim H, Kim J, Du EJ, Kang K, Lim HH, Moon D, Kim K.
A sensory-motor neuron type mediates proprioceptive coordination of steering in C. elegans via two TRPC channels.
PLoS Biol 2018 16(6) e2004929 
[ PubMed ID = 29883446 ] [ RRC reference ]