Mutants (Isolated)

tm1217

Allele Name

tm1217

Sequence Name

D2005.5

CGC Name

drh-3

Worm Base

Allele Name

tm1217

CGC Name

drh-3

Sequence

D2005.5

Phenotype

lethal or sterile. Dr. C. Mello, Cell 124, 343-354 (2006)

Mutation site

38214/38215-38696/38697 (482 bp deletion)

Chromosome

Putative gene structure

join(37322..37419, 37479..37652, 37906..37981, 38029..38110, 38156..38680, 38868..38993, 39040..39221, 39303..39484, 39682..40007, 40444..40724, 40768..41676, 41900..42034, 42116..42216, 42273..42411, 42459..42565, 42668..42719)

Map position

2.37

Balancer

hT2 [qIs48]

Map position of balancer

Sequence of primers

ExtFwd:ATTGATTCCGCCGTTGCTCA,IntFwd:CTTCCCTTCCTGACACTACT,ExtRev:TAACCACCGCATCTGGATCT,IntRev:TCTTACTGTAGCCGCTGTCT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res 2019 47(11) 5603-5616
[ PubMed ID = 31216042 ] [ RRC reference ]

Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet 2018 14(3) e1007252
[ PubMed ID = 29579041 ] [ RRC reference ]

Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34
[ PubMed ID = 20223951 ] [ RRC reference ]

Avgousti DC, Palani S, Sherman Y, Grishok A.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
EMBO J 2012 31(19) 3821-32
[ PubMed ID = 22863779 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624
[ PubMed ID = 19714217 ] [ RRC reference ]

Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog 2009 5(2) e1000286
[ PubMed ID = 19197349 ] [ RRC reference ]

Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte D Jr, Pang K, Brownell DR, Harding S, Mitani S, Ruvkun G, Yates JR 3rd, Mello CC.
Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways.
Cell 2006 124(2) 343-54
[ PubMed ID = 16439208 ] [ RRC reference ]