Mutants (Isolated)

tm1217

Allele Nametm1217
Sequence NameD2005.5
CGC Namedrh-3
Worm BaseAllele Name tm1217
CGC Name drh-3
Sequence D2005.5
Phenotypelethal or sterile. Dr. C. Mello, Cell 124, 343-354 (2006)
Mutation site38214/38215-38696/38697 (482 bp deletion)
ChromosomeI
Putative gene structurejoin(37322..37419, 37479..37652, 37906..37981, 38029..38110, 38156..38680, 38868..38993, 39040..39221, 39303..39484, 39682..40007, 40444..40724, 40768..41676, 41900..42034, 42116..42216, 42273..42411, 42459..42565, 42668..42719)
Map position2.37
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:ATTGATTCCGCCGTTGCTCA,IntFwd:CTTCCCTTCCTGACACTACT,ExtRev:TAACCACCGCATCTGGATCT,IntRev:TCTTACTGTAGCCGCTGTCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Fassnacht C, Tocchini C, Kumari P, Gaidatzis D, Stadler MB, Ciosk R.
The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.
PLoS Genet. 2018 14(3) e1007252 
[ PubMed ID = 29579041 ] [ RRC reference ]

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res. 2019 47(11) 5603-5616 
[ PubMed ID = 31216042 ] [ RRC reference ]

Avgousti DC, Palani S, Sherman Y, Grishok A.
CSR-1 RNAi pathway positively regulates histone expression in C. elegans.
EMBO J. 2012 31(19) 3821-32 
[ PubMed ID = 22863779 ] [ RRC reference ]

Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34 
[ PubMed ID = 20223951 ] [ RRC reference ]

Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog. 2009 5(2) e1000286 
[ PubMed ID = 19197349 ] [ RRC reference ]

Duchaine TF, Wohlschlegel JA, Kennedy S, Bei Y, Conte D Jr, Pang K, Brownell DR, Harding S, Mitani S, Ruvkun G, Yates JR 3rd, Mello CC.
Functional proteomics reveals the biochemical niche of C. elegans DCR-1 in multiple small-RNA-mediated pathways.
Cell 2006 124(2) 343-54 
[ PubMed ID = 16439208 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol. Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]