Mutants (Isolated)

tm1210

Allele Nametm1210
Allele TypeNormal
Sequence NameY56A3A.14
Gene Namesdz-33
Worm BaseAllele Name tm1210
Gene Name sdz-33
Sequence Y56A3A.14
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 73531/73532-G-74078/74079 (547 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(73730..73812, 73856..74675)
Map position13.31
Balancer
Map position of balancer
Sequence of primersExtFwd:ATGCGCTGAGAGGGAGACCA,IntFwd:TAGACAGCGGGGGACTTAAG,ExtRev:GGAGTGTCAGATGGCTGGGT,IntRev:TCGTACCCTTAGCGAATTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shimizu T, Pastuhov SI, Hanafusa H, Sakai Y, Todoroki Y, Hisamoto N, Matsumoto K.
Caenorhabditis elegans F-Box Protein Promotes Axon Regeneration by Inducing Degradation of the Mad Transcription Factor.
J Neurosci 2021 41(11) 2373-2381 
[ PubMed ID = 33514673 ] [ RRC reference ]