Mutants (Isolated)

tm1203

Allele Nametm1203
Sequence NameR07E5.8
CGC Namecku-80
Worm BaseAllele Name tm1203
CGC Name cku-80
Sequence R07E5.8
Phenotypehomozygous viable.Dr. T. Schedl: could not recover mutants. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006). Dr. J-L. Bessereau: in frame deletion and no phenotype.
Mutation site27310/27311-27901/27902 (591 bp deletion)
ChromosomeIII
Putative gene structurejoin(26798..26938, 26986..27181, 27231..27408, 27455..27538, 27861..27933, 27984..28394, 28840..29155, 29208..29268, 29314..29399, 29453..29871, 29924..30056, 30110..30198)
Map position-3.17
Balancer
Map position of balancer
Sequence of primersExtFwd:TGACGGTGAACTGTCCGCGT,IntFwd:ACTGTCCGCGTGCACCAGAT,ExtRev:ACATTCTCCGTCGTTGCGAG,IntRev:TAGCACTCCACCAGTCTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li X, O'Neil NJ, Moshgabadi N, Hieter P.
Synthetic cytotoxicity: digenic interactions with TEL1/ATM mutations reveal sensitivity to low doses of camptothecin.
Genetics 2014 197(2) 611-23 
[ PubMed ID = 24653001 ] [ RRC reference ]

Clejan I, Boerckel J, Ahmed S.
Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
Genetics 2006 173(3) 1301-17 
[ PubMed ID = 16702421 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54 
[ PubMed ID = 18780750 ] [ RRC reference ]