Mutants (Isolated)

tm1195

Allele Nametm1195
Sequence NameK12B6.1
CGC Namesago-1
Worm BaseAllele Name tm1195
CGC Name sago-1
Sequence K12B6.1
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site27251/27252-27672/27673 (421 bp deletion)
ChromosomeV
Putative gene structurejoin(26237..26396, 26448..26701, 26847..27049, 27100..27272, 27325..27450, 27796..28106, 28153..28439, 28493..28586, 28730..28918, 28969..29079, 29125..29214, 29259..29510, 29851..30027, 30078..30199, 30277..30373)
Map position-0.19
Balancer
Map position of balancer
Sequence of primersIntRev:CGAGTCCAGTCACACTCTCT,ExtRev:CCGGTTTTGGAAGAACGAGT,IntFwd:AAGTCACCAGCAGCATGGCT,ExtFwd:CACAACACTCGCCATGTCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Corrêa RL, Steiner FA, Berezikov E, Ketting RF.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
PLoS Genet. 2010 6(4) e1000903 
[ PubMed ID = 20386745 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat. Genet. 2012 44(2) 157-64 
[ PubMed ID = 22231482 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]