Mutants (Isolated)

tm1192

Allele Nametm1192
Sequence NameF20B4.6
CGC Namecgt-2
Worm BaseAllele Name tm1192
CGC Name cgt-2
Sequence F20B4.6
Phenotypehomozygous viable
Mutation site9308/9309-AG-9661/9662 (353 bp deletion + 2 bp insertion)
ChromosomeX
Putative gene structurejoin(6817..7064, 8321..8556, 8602..8822, 9048..9371, 10039..10170, 11596..11766)
Map position24.62
Balancer
Map position of balancer
Sequence of primersExtRev:GAAAGTATCGACTCCACCGT,IntRev:CCAACCCTTCACTACCCGGA,ExtFwd:CCACGCATCTTATGGCTGTA,IntFwd:TGCAGAAGGGAAGCAATCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nomura KH, Murata D, Hayashi Y, Dejima K, Mizuguchi S, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Hirabayashi Y, Ito M, Nomura K.
Ceramide glucosyltransferase of the nematode Caenorhabditis elegans is involved in oocyte formation and in early embryonic cell division.
Glycobiology 2011 21(6) 834-48 
[ PubMed ID = 21325339 ] [ RRC reference ]

Marza E, Simonsen KT, Faergeman NJ, Lesa GM.
Expression of ceramide glucosyltransferases, which are essential for glycosphingolipid synthesis, is only required in a small subset of C. elegans cells.
J. Cell. Sci. 2009 122(Pt 6) 822-33 
[ PubMed ID = 19240113 ] [ RRC reference ]