Mutants (Isolated)

tm1191

Allele Nametm1191
Sequence NameF44F4.2
CGC Nameegg-3
Worm BaseAllele Name tm1191
CGC Name egg-3
Sequence F44F4.2
Phenotypelethal or sterile. Dr. S. L'Hernault: could not recover. Dr. A. Singson: Current Biology 17, 1555 (2007)
Mutation site4180/4181-4610/4611 (430 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(3289..3637, 3684..4127, 4179..4585, 4634..4736, 4787..5016, 5062..5196))
Map position3.13
BalancermIn1 [mIs14]
Map position of balancer
Sequence of primersExtRev:ACAGACAATGATGCCCCTGT,ExtFwd:GCCGGTGTGATACGGCTAAA,IntRev:CAACTATGTGCGCTACCGTA,IntFwd:GCAGACGAACGAAGACGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Maruyama R, Velarde NV, Klancer R, Gordon S, Kadandale P, Parry JM, Hang JS, Rubin J, Stewart-Michaelis A, Schweinsberg P, Grant BD, Piano F, Sugimoto A, Singson A.
EGG-3 regulates cell-surface and cortex rearrangements during egg activation in Caenorhabditis elegans.
Curr. Biol. 2007 17(18) 1555-60 
[ PubMed ID = 17869112 ] [ RRC reference ]

Stitzel ML, Cheng KC, Seydoux G.
Regulation of MBK-2/Dyrk kinase by dynamic cortical anchoring during the oocyte-to-zygote transition.
Curr. Biol. 2007 17(18) 1545-54 
[ PubMed ID = 17869113 ] [ RRC reference ]

Cheng KC, Klancer R, Singson A, Seydoux G.
Regulation of MBK-2/DYRK by CDK-1 and the pseudophosphatases EGG-4 and EGG-5 during the oocyte-to-embryo transition.
Cell 2009 139(3) 560-72 
[ PubMed ID = 19879842 ] [ RRC reference ]