Home > Mutants (Isolated) > tm1191

Mutants (Isolated)

Allele Name		tm1191
Allele Type		Balanced
Sequence Name		F44F4.2
Gene Name		egg-3
Worm Base	Allele Name	tm1191
	Gene Name	egg-3
	Sequence	F44F4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. S. L'Hernault: could not recover. Dr. A. Singson: Current Biology 17, 1555 (2007)
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		4180/4181-4610/4611 (430 bp deletion)
Chromosome		II
Putative gene structure		complement(join(3289..3637, 3684..4127, 4179..4585, 4634..4736, 4787..5016, 5062..5196))
Map position		3.13
Balancer		mIn1 [e128 mIs14]
Map position of balancer
Sequence of primers		ExtRev:ACAGACAATGATGCCCCTGT,ExtFwd:GCCGGTGTGATACGGCTAAA,IntRev:CAACTATGTGCGCTACCGTA,IntFwd:GCAGACGAACGAAGACGCAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Kawasaki I, Sugiura K, Sasaki T, Matsuda N, Sato M, Sato K. MARC-3, a membrane-associated ubiquitin ligase, is required for fast polyspermy block in Caenorhabditis elegans. Nat Commun 2024 15(1) 792  [ PubMed ID = 38278786 ] [ RRC reference ] Singaravelu G, Rahimi S, Krauchunas A, Rizvi A, Dharia S, Shakes D, Smith H, Golden A, Singson A. Forward Genetics Identifies a Requirement for the Izumo-like Immunoglobulin Superfamily spe-45 Gene in Caenorhabditis elegans Fertilization. Curr Biol 2015 25(24) 3220-4  [ PubMed ID = 26671668 ] [ RRC reference ] Cheng KC, Klancer R, Singson A, Seydoux G. Regulation of MBK-2/DYRK by CDK-1 and the pseudophosphatases EGG-4 and EGG-5 during the oocyte-to-embryo transition. Cell 2009 139(3) 560-72  [ PubMed ID = 19879842 ] [ RRC reference ] Stitzel ML, Cheng KC, Seydoux G. Regulation of MBK-2/Dyrk kinase by dynamic cortical anchoring during the oocyte-to-zygote transition. Curr Biol 2007 17(18) 1545-54  [ PubMed ID = 17869113 ] [ RRC reference ] Maruyama R, Velarde NV, Klancer R, Gordon S, Kadandale P, Parry JM, Hang JS, Rubin J, Stewart-Michaelis A, Schweinsberg P, Grant BD, Piano F, Sugimoto A, Singson A. EGG-3 regulates cell-surface and cortex rearrangements during egg activation in Caenorhabditis elegans. Curr Biol 2007 17(18) 1555-60  [ PubMed ID = 17869112 ] [ RRC reference ]