Mutants (Isolated)

tm1186

Allele Nametm1186
Sequence NameT22H9.3
CGC Namewago-10
Worm BaseAllele Name tm1186
CGC Name wago-10
Sequence T22H9.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site14409/14410-G-14835/14836 (426 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structurejoin(14016..14133, 14190..14394, 14835..15668, 15717..16235, 16321..17266, 17585..17775, 17825..17984)
Map position-20
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCCCCGTGAGAGACTCAGA,ExtFwd:CAGTACAATTGTGGGTCCAA,IntRev:CGAGACCACCAGTGGCATTT,ExtRev:CCCGGAGCAACTTGCAGCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]