Mutants (Isolated)

tm1185

Allele Nametm1185
Sequence NameR04B5.3
CGC Namenhr-205
Worm BaseAllele Name tm1185
CGC Name nhr-205
Sequence R04B5.3
Phenotypehomozygous viable.
Mutation site4049/4050-5277/5278 (1228 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(3723..3827, 3878..4145, 4193..4301, 4373..4846, 4897..4982, 5160..5281))
Map position2.26
Balancer
Map position of balancer
Sequence of primersIntRev:ACTTGGACCAGGCAACGTAT,ExtRev:GGCTACAAACGTAGGCAGTA,ExtFwd:CGGTACTCTACACTAGAGGA,IntFwd:TCGACAGACGATTCTCTGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]