Mutants (Isolated)

tm1184

Allele Nametm1184
Allele TypeNormal
Sequence NameZK757.3
Gene Namealg-4
Worm BaseAllele Name tm1184
Gene Name alg-4
Sequence ZK757.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24969/24970-TTTTCTTC-25740/25741 (771 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(Z30215.1:861..915, Z30215.1:201..373, 25676..25848, 24734..25627, 24473..24689, 23916..24423, 23604..23866, 23434..23558, 22889..23386, 22717..22841, 22579..22670))
Map position1.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTCCTTCGATCTTCCGTAC,IntFwd:GGCCAACGCGGGAAGTTCAT,ExtRev:GTTAGGCTAGCTGTAAGCAT,IntRev:GATCTCAGGATCTGGTTCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Charlesworth AG, Seroussi U, Lehrbach NJ, Renaud MS, Sundby AE, Molnar RI, Lao RX, Willis AR, Woock JR, Aber MJ, Diao AJ, Reinke AW, Ruvkun G, Claycomb JM.
Two isoforms of the essential C. elegans Argonaute CSR-1 differentially regulate sperm and oocyte fertility.
Nucleic Acids Res 2021 49(15) 8836-8865 
[ PubMed ID = 34329465 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]

Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2010 107(8) 3588-93 
[ PubMed ID = 20133686 ] [ RRC reference ]

Han T, Manoharan AP, Harkins TT, Bouffard P, Fitzpatrick C, Chu DS, Thierry-Mieg D, Thierry-Mieg J, Kim JK.
26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2009 106(44) 18674-9 
[ PubMed ID = 19846761 ] [ RRC reference ]