Mutants (Isolated)

tm1184

Allele Nametm1184
Sequence NameZK757.3
CGC Namealg-4
Worm BaseAllele Name tm1184
CGC Name alg-4
Sequence ZK757.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site24969/24970-TTTTCTTC-25740/25741 (771 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(Z30215.1:861..915, Z30215.1:201..373, 25676..25848, 24734..25627, 24473..24689, 23916..24423, 23604..23866, 23434..23558, 22889..23386, 22717..22841, 22579..22670))
Map position1.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTCCTTCGATCTTCCGTAC,IntFwd:GGCCAACGCGGGAAGTTCAT,ExtRev:GTTAGGCTAGCTGTAAGCAT,IntRev:GATCTCAGGATCTGGTTCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3588-93 
[ PubMed ID = 20133686 ] [ RRC reference ]

Han T, Manoharan AP, Harkins TT, Bouffard P, Fitzpatrick C, Chu DS, Thierry-Mieg D, Thierry-Mieg J, Kim JK.
26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2009 106(44) 18674-9 
[ PubMed ID = 19846761 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]