Mutants (Isolated)

tm1183

Allele Nametm1183
Sequence NameF56A3.5
CGC Namebro-1
Worm BaseAllele Name tm1183
CGC Name bro-1
Sequence F56A3.5
Phenotypehomozygous viable
Mutation site16215/16216-16981/16982 (766 bp deletion)
ChromosomeI
Putative gene structurejoin(15956..16120, 16553..16618, 17360..17587)
Map position-0.3
Balancer
Map position of balancer
Sequence of primersExtRev:CCGTTCAATTCACGAAGCAT,IntRev:GGACCTGCGAGTTGTAACAA,IntFwd:CCGACAACATTTGTCGGTGA,ExtFwd:TTCTTGTGACTCCGCCTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hughes S, Brabin C, Appleford PJ, Woollard A.
CEH-20/Pbx and UNC-62/Meis function upstream of rnt-1/Runx to regulate asymmetric divisions of the C. elegans stem-like seam cells.
Biol Open 2013 2(7) 718-27 
[ PubMed ID = 23862020 ] [ RRC reference ]

Hajduskova M, Jindra M, Herman MA, Asahina M.
The nuclear receptor NHR-25 cooperates with the Wnt/beta-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans.
J. Cell. Sci. 2009 122(Pt 17) 3051-60 
[ PubMed ID = 19654209 ] [ RRC reference ]

Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15 
[ PubMed ID = 17933794 ] [ RRC reference ]