Mutants (Isolated)

tm1181

Allele Nametm1181
Sequence NameF56D2.1
CGC Nameucr-1
Worm BaseAllele Name tm1181
CGC Name ucr-1
Sequence F56D2.1
Phenotypelethal or sterile
Mutation site14518/14519-TCTTTTNG-15010/15011 (492 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurejoin(13609..13662, 13805..13930, 13980..14196, 14246..14445, 14490..14732, 14782..14839, 14897..15008, 15061..15271, 15322..15451, 15518..15582)
Map position-1.52
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:GGGATCGGGATCTGCGGTTA,IntFwd:GCGTCCGCTGCCATCTAAAT,ExtRev:GTAACAAACCTCCTTAGCGT,IntRev:TGGTCTCGAGGTTCTGGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nomura H, Athauda SB, Wada H, Maruyama Y, Takahashi K, Inoue H.
Identification and reverse genetic analysis of mitochondrial processing peptidase and the core protein of the cytochrome bc1 complex of Caenorhabditis elegans, a model parasitic nematode.
J. Biochem. 2006 139(6) 967-79 
[ PubMed ID = 16788047 ] [ RRC reference ]