Mutants (Isolated)

tm1177

Allele Nametm1177
Sequence NameCD4.2
CGC Namecrn-2
Worm BaseAllele Name tm1177
CGC Name crn-2
Sequence CD4.2
Phenotypehomozygous viable
Mutation site13125/13126-13540/13541 (415 bp deletion)
ChromosomeV
Putative gene structurejoin(12738..12933, 12995..13250, 13302..13459, 13508..13758)
Map position-1.36
Balancer
Map position of balancer
Sequence of primersExtFwd:ACGTCCGAATTCAAGGACAC,ExtRev:AGACTCAGCAGAGCCGGATT,IntFwd:TGATCCGAATGTACGCCGCA,IntRev:CTTCGGATCTCGACCGGCAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34 
[ PubMed ID = 20223951 ] [ RRC reference ]