Home > Mutants (Isolated) > tm1159

Mutants (Isolated)

Allele Name		tm1159
Allele Type		Balanced
Sequence Name		Y56A3A.32
Gene Name		wah-1
Worm Base	Allele Name	tm1159
	Gene Name	wah-1
	Sequence	Y56A3A.32
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		162524/162525-163109/163110 (585 bp deletion)
Chromosome		III
Putative gene structure		join(156401..156515, 157981..158501, 161588..161962, 162978..163573, 164609..164771, 165492..165653)
Map position		13.8
Balancer		egl-35 (n694) III
Map position of balancer
Sequence of primers		ExtRev:CAGCAGTCGCCATATTCTCT,IntRev:CCAGCCAGTCGTCCACTAAT,ExtFwd:CTGGTGGTATGGAGACGAAA,IntFwd:CGAAACATCCGCAACGAAAC
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Lin JLJ, Nakagawa A, Skeen-Gaar R, Yang WZ, Zhao P, Zhang Z, Ge X, Mitani S, Xue D, Yuan HS. Oxidative Stress Impairs Cell Death by Repressing the Nuclease Activity of Mitochondrial Endonuclease G. Cell Rep 2016 16(2) 279-287  [ PubMed ID = 27346342 ] [ RRC reference ] Niwa S, Tao L, Lu SY, Liew GM, Feng W, Nachury MV, Shen K. BORC Regulates the Axonal Transport of Synaptic Vesicle Precursors by Activating ARL-8. Curr Biol 2017 27(17) 2569-2578.e4  [ PubMed ID = 28823680 ] [ RRC reference ]